ID: 1032646819

View in Genome Browser
Species Human (GRCh38)
Location 7:133834099-133834121
Sequence CTTATTTGAAGCAGAATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 1, 2: 3, 3: 18, 4: 255}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032646819 Original CRISPR CTTATTTGAAGCAGAATTGT GGG Intronic
901133190 1:6975636-6975658 CTTCATTGAGACAGAATTGTAGG + Intronic
901898327 1:12334951-12334973 CTTTTTGGAAGAAGAATTATTGG - Intronic
903097065 1:20986962-20986984 CTCATTTGAGGCAGTATTTTGGG + Intronic
904174388 1:28616055-28616077 CTGATTTGAAGTATAATTGATGG - Intronic
905551520 1:38844512-38844534 CTTCTCTGAAGCTGAATTCTTGG - Intronic
906376694 1:45302371-45302393 TTTCTTGGAAGTAGAATTGTTGG - Intronic
909386610 1:75065258-75065280 CTTTTTTGATGTAGAATGGTAGG + Intergenic
909766502 1:79362513-79362535 ATAATTTGTGGCAGAATTGTTGG - Intergenic
910545083 1:88406796-88406818 CTTATTTCAACAAGATTTGTGGG - Intergenic
910820171 1:91337367-91337389 ACTATATGAAGCAGAATTATAGG + Intronic
911312143 1:96306284-96306306 CATAAATGATGCAGAATTGTAGG + Intergenic
913649771 1:120901504-120901526 CTTATTTGAAGAGGAAATTTAGG + Intergenic
914076913 1:144362024-144362046 CTTATTTGAAGAGGAAATTTAGG - Intergenic
914102265 1:144604481-144604503 CTTATTTGAAGAGGAAATTTAGG + Intergenic
914171362 1:145227593-145227615 CTTATTTGAAGAGGAAATTTAGG - Intergenic
914296633 1:146332715-146332737 CTTATTTGAAGAGGAAATTTAGG - Intergenic
914526471 1:148471559-148471581 CTTATTTGAAGAGGAAATTTAGG - Intergenic
914639933 1:149595563-149595585 CTTATTTGAAGAGGAAATTTAGG + Intergenic
916568806 1:166007599-166007621 TTTATTTGAAGCTGACTTCTTGG + Intergenic
918770360 1:188549711-188549733 TTTATTTGAAAAAGAGTTGTTGG + Intergenic
919036504 1:192317322-192317344 CAAATTTGAAGCAGACTAGTTGG - Intronic
919885904 1:201934587-201934609 CTAATGGGAAGCAGAATAGTAGG - Intronic
920943121 1:210502534-210502556 CTTATTGGCCGCATAATTGTGGG + Intronic
921739445 1:218667166-218667188 GTTCTTAGAAGCAGAATTGTGGG - Intergenic
922031589 1:221805865-221805887 ATTATTAGAAGTAGAATTGCTGG - Intergenic
922372565 1:224926001-224926023 CTTGTTTGAAGCAGAATCGGGGG - Intronic
922513550 1:226189165-226189187 TTTATTAGAAGCTGTATTGTAGG + Intergenic
922609617 1:226915668-226915690 CTGATGTATAGCAGAATTGTAGG - Intronic
922984852 1:229858235-229858257 CTTCCTTGAAGTAGAATTGCTGG - Intergenic
1064626310 10:17265430-17265452 CTAATTTAAAGCAGAAATGATGG - Intergenic
1065643204 10:27805894-27805916 TATATTTGAAGGAGAATAGTGGG + Intergenic
1066954917 10:42156687-42156709 CATATTTGCAGCAGCATTATTGG + Intergenic
1067896763 10:50190205-50190227 TTTGTTTGAAGCTGAATTCTTGG - Intronic
1067952208 10:50751828-50751850 TTTGTTTGAAGCTGAATTCTTGG + Intronic
1068433019 10:56957385-56957407 CTTAATTGAAGAATAATTGAAGG - Intergenic
1068617412 10:59134811-59134833 GTTATTTGCATCAGAACTGTGGG - Intergenic
1069274782 10:66576237-66576259 CTTAATTGAATCAGAATCTTAGG - Intronic
1070199013 10:74185530-74185552 TTTTTTTGAAGCAGAGTCGTCGG + Intronic
1072441577 10:95460805-95460827 CTTACATGAAGCAGCATTTTTGG - Intronic
1073813065 10:107172286-107172308 CTTCTTTGCAGCATAATTCTTGG + Intergenic
1077458507 11:2695656-2695678 TTTATTTGAGGAAGAAGTGTTGG + Intronic
1077832701 11:5892154-5892176 CTTATTTGAAGTAGAATTTTTGG - Intronic
1080001119 11:27351446-27351468 CTTCTATGCAGCAGAATTTTAGG - Intronic
1086088063 11:82976546-82976568 TTGATTTAAAGCAGAATTTTTGG - Exonic
1086978570 11:93166733-93166755 CTGATTGGAAGCAGAATTCAAGG + Intronic
1087476791 11:98646179-98646201 GTATTTTGAAGCAGAAATGTTGG + Intergenic
1090306384 11:125694666-125694688 CATAAATGAAGCAGAAATGTGGG + Intergenic
1090673203 11:128965223-128965245 CTTATTTGAAGCTGAGTTGTGGG - Exonic
1091416253 12:287892-287914 CTTATTTGTAAGAGAATTTTGGG - Intronic
1093140114 12:15500020-15500042 CTAATATGAAGCACTATTGTAGG + Intronic
1093214176 12:16343835-16343857 GTATTTAGAAGCAGAATTGTTGG + Intergenic
1094196238 12:27752827-27752849 ATTATTTGCAGCAGAGTTGTGGG + Intronic
1096232676 12:49905064-49905086 CTTCTTTTAGGCAGATTTGTGGG - Intergenic
1097456820 12:59809184-59809206 CTATATTGAAGCAGAATTCTGGG - Intergenic
1098079590 12:66769946-66769968 CTTGTTTGAAGGACAACTGTTGG + Intronic
1098214033 12:68196746-68196768 CTTTCTAGAAGCAGGATTGTGGG - Intergenic
1100276488 12:93076474-93076496 CCTTTTTGAAGCAGAGCTGTAGG + Intergenic
1103234924 12:119363821-119363843 TTTATTGGAGACAGAATTGTAGG + Intronic
1106582320 13:31028900-31028922 CTTATTGGAAACAGAATGGGTGG - Intergenic
1107325918 13:39242260-39242282 GTTCTTTGTAGCAGAATTGGAGG - Intergenic
1109255209 13:60071948-60071970 CTGATGGGAAGCAGAATTGGGGG - Intronic
1110831327 13:80034957-80034979 CTTTTGTGAATCTGAATTGTGGG - Intergenic
1111633493 13:90873797-90873819 CGTATTTGAAGGAAAATTATAGG - Intergenic
1111964752 13:94849221-94849243 CTTATTTTAACAAGATTTGTTGG + Intergenic
1112475409 13:99727238-99727260 CTTGTTTGAAGCCTAATTGCAGG + Intronic
1113279756 13:108776587-108776609 CCTATTTGAAGCAGTTTTATTGG - Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1117421742 14:55553414-55553436 ATTATTAGAAGTTGAATTGTTGG - Intergenic
1117523031 14:56570015-56570037 CATATGTGAATCAGAATTGTGGG - Intronic
1118072032 14:62255956-62255978 TTTTTTTGAGACAGAATTGTTGG + Intergenic
1120223222 14:81759151-81759173 GCTTTTTGAAGCAGAATTTTAGG - Intergenic
1121621013 14:95348312-95348334 CTCTTTGGAAGCAGAAATGTGGG - Intergenic
1124156714 15:27232623-27232645 ATGATTAAAAGCAGAATTGTAGG - Intronic
1126495340 15:49283944-49283966 TATATGTGAAGCAGAATTATAGG + Intronic
1129637077 15:77331553-77331575 ATTATTTTAAGTACAATTGTTGG + Intronic
1133182425 16:4067492-4067514 CTAATTTGAAGCAGAAGTCCTGG - Intronic
1135276986 16:21121734-21121756 CTTGTTAGAAGCACAATTCTGGG + Intronic
1135776562 16:25261778-25261800 CTTATTTGAATCTGAATCCTGGG - Intergenic
1137741867 16:50784780-50784802 ATTACTTGTAGCAGAAGTGTTGG - Intronic
1138127464 16:54450769-54450791 ATTCTTAGAAGCAGAATTGCTGG + Intergenic
1139031157 16:62882522-62882544 ATTATTTGAAGCACAACTATGGG + Intergenic
1140315561 16:73893240-73893262 TTTATTTGAAACAGAACTCTTGG + Intergenic
1141024132 16:80528107-80528129 AATATTTGAGGCAGAATCGTGGG - Intergenic
1141801410 16:86311824-86311846 ATCATTTAAAACAGAATTGTAGG - Intergenic
1144286669 17:13782126-13782148 ATGATTAGAAGCAGAATTTTTGG - Intergenic
1148667298 17:49384194-49384216 ATTTTTTGGAGCACAATTGTGGG - Intronic
1148876306 17:50689506-50689528 CTTCTTTGAAGGAGTATAGTGGG + Intronic
1149014526 17:51892360-51892382 CATAATTAAAGCAGAATTGAAGG - Intronic
1149189522 17:54042696-54042718 CTTATTAGATGCTGAAGTGTTGG + Intergenic
1149960509 17:61104667-61104689 CTTTAATGAAGCAGAATTGATGG - Intronic
1150035972 17:61798024-61798046 CTTTTTAGAAGTGGAATTGTTGG - Intronic
1150198226 17:63324101-63324123 CTTTTTTGAAGAAGAATTTTAGG - Intronic
1151116517 17:71741297-71741319 CTTATTTGTAGCAAAGTAGTTGG + Intergenic
1151298174 17:73201194-73201216 CTTATTTGAAGGGGAGTTGCTGG - Exonic
1155447813 18:25930218-25930240 TTTCTTAAAAGCAGAATTGTGGG - Intergenic
1156377765 18:36530208-36530230 CTTATTTTAAGCTGAGTGGTGGG - Intronic
1158384814 18:56977216-56977238 TTAATTTGAAAGAGAATTGTTGG + Intronic
1158803451 18:60941793-60941815 CTTATGTGAACCAGTATTTTTGG - Intergenic
1159487875 18:69088929-69088951 CGTATTTGAAAGAGAATAGTGGG + Intergenic
1163335368 19:16667906-16667928 TTCATTTAAATCAGAATTGTGGG + Intronic
1165221718 19:34321933-34321955 ATAATGTGAAGGAGAATTGTGGG + Intronic
1167226689 19:48248550-48248572 CTTATTTCCATCAGTATTGTGGG - Intronic
925314551 2:2911286-2911308 TTTCTATGAAGCAGAATGGTAGG + Intergenic
925397804 2:3549104-3549126 CTGTTTTGAAACAGAAATGTAGG - Exonic
925974548 2:9132572-9132594 CCTATTTAAAGAACAATTGTAGG - Intergenic
926342003 2:11911397-11911419 CATATTTGAAGTAGACATGTGGG + Intergenic
926361436 2:12091694-12091716 CTTATTTGAAACCAACTTGTGGG - Intergenic
927037678 2:19196622-19196644 CTTCTTTGTGGCAGAATTGTGGG - Intergenic
928358893 2:30647203-30647225 GTTCTTAGAAGCAGGATTGTGGG - Intergenic
932537452 2:72614650-72614672 CTTGTTTTAAGCAGAAGTGCTGG - Intronic
933360921 2:81282908-81282930 CTTGTTGAAAGCAGAAATGTTGG - Intergenic
933797782 2:85934528-85934550 TTTAATTGAAACAGAATTGCCGG - Intergenic
935346146 2:102110356-102110378 ATTCCTGGAAGCAGAATTGTGGG + Intronic
937152294 2:119694434-119694456 CATATCTGAAGCAGAGGTGTGGG + Intergenic
938142876 2:128811228-128811250 TTGATTTCAAGCAAAATTGTAGG - Intergenic
938319261 2:130352131-130352153 CCTTTCTGAAGCAGAATTGCAGG + Intergenic
938968782 2:136412415-136412437 CTTATTTGAAGGAGATTCCTGGG + Intergenic
939034579 2:137115357-137115379 CTTATTTCAAGAAGAATACTTGG - Intronic
939616894 2:144371829-144371851 GTTATTTGAAGAAGAATCATGGG - Intergenic
940835689 2:158518783-158518805 CATATTTGAATCATAATTTTTGG + Intronic
944819753 2:203418529-203418551 CCTATGTGATCCAGAATTGTGGG - Intronic
945705737 2:213229040-213229062 CTTCTGTGAAGCAGAGTTATGGG + Intergenic
945983585 2:216336833-216336855 TTTATTTGAAGCAGAATTGTTGG - Intronic
946721459 2:222613176-222613198 TTTATTTGAATCAGAATTTAAGG - Intronic
948596918 2:239085546-239085568 CTAATTTGAACCTGAGTTGTTGG - Intronic
1169471983 20:5894360-5894382 CTGATTTGAAACAGCCTTGTTGG - Intergenic
1173002394 20:39113916-39113938 CTTAATTGAAGCAGCATTAATGG - Intergenic
1173673317 20:44812677-44812699 CTTGTTTGGATCAGAAATGTTGG + Intergenic
1175031727 20:55961446-55961468 CTTGTTGGATGCAGAATTATTGG - Intergenic
1175318306 20:58067737-58067759 CTTATCTGAAGCAGAAGTTGCGG + Intergenic
1176727574 21:10453126-10453148 CCTGTTTGAAGCAGCATTTTTGG + Intergenic
1177185126 21:17785152-17785174 AGTATTTGAATCAGATTTGTTGG - Intergenic
1178174435 21:30080026-30080048 CTAATTTGAAGAAGAATTAGAGG - Intergenic
1178192152 21:30296417-30296439 CTAATTTGAGACAGAATTGAGGG - Intergenic
1178497170 21:33096980-33097002 ATTATTTGAAGAAAGATTGTAGG - Intergenic
1180159204 21:45991571-45991593 CTTTGTTGAAGCTGAAGTGTTGG + Intronic
1180286820 22:10753905-10753927 CCTGTTTGAAGCAGCATTTTTGG - Intergenic
949332659 3:2939416-2939438 CTTATTCTAGGGAGAATTGTAGG - Intronic
949359135 3:3213237-3213259 CTTATTTAAAGCATAATATTTGG - Intergenic
949373344 3:3359590-3359612 TCTTTTTGAAGCAGAATTGAAGG + Intergenic
949777704 3:7651006-7651028 TTGATTTGAAGGAAAATTGTGGG + Intronic
950266614 3:11577898-11577920 GTAATTTGAAGGAGAATTCTGGG - Intronic
952260135 3:31732031-31732053 CTTATTTCTAGCAGCATTCTTGG - Intronic
955063181 3:55511915-55511937 CTCATCTGAAGCAGTAGTGTGGG - Intronic
956931774 3:74051669-74051691 ATTCTTTGAAGTGGAATTGTTGG - Intergenic
957251352 3:77774765-77774787 TTTACTTGAAGAAGAATTGGAGG - Intergenic
957439103 3:80219125-80219147 CGTATTTGAAGAAGTATTGCTGG + Intergenic
957798380 3:85042295-85042317 CAAACTTGAAACAGAATTGTTGG + Intronic
958034298 3:88151553-88151575 CTTGTTAGAAGCAGAATTTCTGG - Intronic
958727026 3:97918509-97918531 CTTATTTGCAACAGAACTGGAGG - Intronic
960124362 3:113982193-113982215 ATTATTTTCAGCTGAATTGTGGG + Intronic
960484898 3:118239673-118239695 GCTGTTTGAAGCATAATTGTAGG - Intergenic
961056736 3:123795206-123795228 CTTATTTTAAGAAAAGTTGTAGG - Intronic
963510869 3:146247237-146247259 ATTATTGGAAGCAGAACTGATGG + Intronic
963585219 3:147178238-147178260 CTGATTTGGAGCAGCATGGTTGG - Intergenic
963616468 3:147544760-147544782 CTGATTTAAAACAGAGTTGTAGG + Intergenic
964234135 3:154505656-154505678 CTTCTTTGAAGCTGAATTTTTGG + Intergenic
964560103 3:157985563-157985585 CTTATTTGATGTAGAAATGGTGG - Intergenic
964723305 3:159789561-159789583 CTTGTTTGAAACACAATTGCTGG + Intronic
966580210 3:181552924-181552946 ACTTTTAGAAGCAGAATTGTTGG - Intergenic
967569088 3:191006982-191007004 TTGATTTGAAGCAAAATTGAAGG + Intergenic
970104180 4:12561583-12561605 CTTATTAGAAGTAGAAGTTTTGG - Intergenic
970189330 4:13496906-13496928 ATTATTTGAAGCTTGATTGTGGG + Intergenic
970833400 4:20369990-20370012 CTCATATGATGCAGAATTGCTGG - Intronic
971830104 4:31681118-31681140 CTTATTTAAAGCAGAAATCTTGG - Intergenic
972171364 4:36349579-36349601 CTTATTGGAAGCAACTTTGTGGG + Intergenic
972410977 4:38794336-38794358 CTTCTTTGAAGCATAATAGTGGG - Intronic
972702947 4:41511473-41511495 CTTGTTTGAAGGAGAAATTTTGG + Intronic
972930608 4:44067380-44067402 TATATTTGAAACAGAATAGTAGG + Intergenic
973749241 4:53996533-53996555 CACATTTGAAGCATAATTATAGG + Intronic
974297408 4:60019500-60019522 CTTACTCTAAGCAGAATTGTAGG - Intergenic
976892769 4:90070514-90070536 CCTATTTGAAGAAAAATTGTGGG + Intergenic
978175392 4:105725346-105725368 CTCATTTGAAGCACAATTACTGG + Intronic
978971848 4:114817360-114817382 ATAATTTGAATGAGAATTGTTGG - Intergenic
979042012 4:115810526-115810548 TTGATTTGTATCAGAATTGTGGG - Intergenic
980709486 4:136545765-136545787 CTTATGTGAGGAAGAAATGTTGG + Intergenic
981319977 4:143380471-143380493 TTTATTTGAGGCAGAACTATGGG - Intronic
981900404 4:149855448-149855470 CTTATTTGCAGCTGTTTTGTTGG - Intergenic
982896818 4:160941058-160941080 CTCATTAGAAAAAGAATTGTTGG + Intergenic
983438177 4:167744193-167744215 CTTATTTGCTGTAGAATTATGGG - Intergenic
984103016 4:175509517-175509539 CTTATTTCCAGCATAATTGGCGG + Intergenic
984434119 4:179686318-179686340 CTTAATTGGAGTAGAATTCTGGG - Intergenic
984451950 4:179913655-179913677 CTAAATTGAAGCAAGATTGTGGG - Intergenic
985816009 5:2128575-2128597 GTTTTTAGAAGCAGAATTTTGGG + Intergenic
985822434 5:2169425-2169447 CATATTTCAAACAGAGTTGTTGG - Intergenic
987111131 5:14688117-14688139 TTTTTCTGAAACAGAATTGTAGG + Intronic
987463256 5:18240959-18240981 TTTATTTGAAGAAAAATTGAAGG - Intergenic
988026888 5:25706901-25706923 CTAATTTGAAGAAAATTTGTGGG - Intergenic
991084624 5:62637143-62637165 CTTACCTGGAGCAGAAGTGTTGG - Intergenic
991267973 5:64745235-64745257 CATGTTTGGAGCAGAATGGTGGG + Intronic
992223786 5:74598675-74598697 CTTTTTAGAAGCAAAATTCTTGG - Intergenic
993327714 5:86562975-86562997 CTTAATAGAAGCAAAATTGGAGG - Intergenic
993798181 5:92296859-92296881 AATATTTGAAGAAGAATTATGGG - Intergenic
995089295 5:108154009-108154031 CAGATTTGAGGCAGATTTGTTGG - Intronic
997705949 5:135952694-135952716 CATACTTGAAGCAGAGTTCTTGG + Intronic
997730396 5:136168151-136168173 CTTTTTTGAAAGAGAATTGAGGG + Intronic
998441658 5:142167806-142167828 CTATATTGCAGCAGAATTGTGGG + Intergenic
998891785 5:146753957-146753979 CTTAAATCAAGCAGAATTGTAGG + Intronic
999065481 5:148681066-148681088 CTTATTTGAAGCACAGTTTTTGG - Intergenic
999716477 5:154364899-154364921 CTTATTTGTAGCTGATTGGTGGG + Intronic
999952752 5:156667895-156667917 CTTAATTGAAAGAGAATTTTTGG - Intronic
1000793104 5:165631142-165631164 CTTATTTGAAGGAGAGAAGTTGG - Intergenic
1003274215 6:4634872-4634894 ATTCTTAGAAGCAAAATTGTTGG - Intergenic
1009581587 6:65541756-65541778 TCTATTTAAAGCAGTATTGTTGG - Intronic
1010497654 6:76554736-76554758 CTGCTATGAAGCAGAAATGTGGG - Intergenic
1010769127 6:79808426-79808448 CCAATTAGTAGCAGAATTGTAGG - Intergenic
1011061953 6:83280001-83280023 ATTACATGATGCAGAATTGTAGG - Intronic
1011515925 6:88153011-88153033 ATTTTTTAAAGCAGAATTCTAGG - Intronic
1012272572 6:97232724-97232746 CTTCTCTGAAGCATAATTTTAGG - Intronic
1013342797 6:109231444-109231466 CTTGGTTGAAGCAGATTTGTTGG + Intergenic
1014790636 6:125668131-125668153 CTGAGTTGAAGCAGACGTGTCGG - Intergenic
1015990272 6:138934113-138934135 CTTATTTGGAGCAAAGTTGAAGG - Intronic
1016871885 6:148825903-148825925 ATTATGAGAAGCAGAGTTGTAGG + Intronic
1017623291 6:156321117-156321139 CTTATTTGCAGCAGCATGGATGG - Intergenic
1018509204 6:164506689-164506711 CTTATCTGAAATAGAATTATAGG - Intergenic
1019029795 6:169000366-169000388 CATATGTAAAGCAGAATGGTGGG + Intergenic
1020954547 7:14724701-14724723 CATCTTTAAAACAGAATTGTAGG - Intronic
1023235893 7:38086512-38086534 CTTATTTGAATAAACATTGTTGG + Intergenic
1025109793 7:56204548-56204570 CATATTTGAAACAGAACTGTGGG - Intergenic
1027736464 7:81938622-81938644 TTTTTTTGAATCAGAATTCTGGG - Intergenic
1028124669 7:87098596-87098618 ATTATTAGAAGTGGAATTGTTGG - Intergenic
1028847405 7:95497359-95497381 CATTTTGGAAGTAGAATTGTTGG + Intronic
1030570682 7:111218926-111218948 CATATTTTAAGCAGAACTCTGGG - Intronic
1030571505 7:111230897-111230919 CTTCTTTGAAGAAGAAATGCTGG + Intronic
1030991818 7:116310190-116310212 CATTCTTGAAGCAGAATTCTTGG + Intronic
1031272470 7:119669523-119669545 CTTACTTGATACAGAATTGTAGG + Intergenic
1031297190 7:120015363-120015385 ATTGTTTGAAGCTGAATTGCTGG - Intergenic
1031839277 7:126717614-126717636 ATTATTTGAAGTAGAAATGCAGG - Intronic
1032646819 7:133834099-133834121 CTTATTTGAAGCAGAATTGTGGG + Intronic
1032692293 7:134300536-134300558 CTGATTTGAAGCAAAATTCCAGG - Intronic
1037131861 8:15415970-15415992 TTTATTTGAAGCACACATGTTGG - Intergenic
1038817430 8:30919386-30919408 CTTTTTTGAATAACAATTGTAGG + Intergenic
1040627925 8:49173403-49173425 CTTATTTCATGGAGACTTGTAGG + Intergenic
1040671951 8:49702732-49702754 ATTATTTTAAGAAAAATTGTGGG + Intergenic
1041854562 8:62436230-62436252 CTTATTTAAAGAACTATTGTTGG - Intronic
1042729266 8:71913295-71913317 CTCTTTTCAAGCAGAAGTGTTGG + Intronic
1043890551 8:85648315-85648337 ATTAGTTGAATTAGAATTGTTGG + Intergenic
1043893939 8:85722192-85722214 ATTAGTTGAATTAGAATTGTTGG - Intergenic
1043894296 8:85725277-85725299 ATTAGTTGAATTAGAATTGTTGG - Intergenic
1043894652 8:85728362-85728384 ATTAGTTGAATTAGAATTGTTGG - Intergenic
1043895008 8:85731447-85731469 ATTAGTTGAATTAGAATTGTTGG - Intergenic
1043897668 8:85750364-85750386 ATTAGTTGAATTAGAATTGTTGG + Intergenic
1043898024 8:85753449-85753471 ATTAGTTGAATTAGAATTGTTGG + Intergenic
1043898383 8:85756534-85756556 ATTAGTTGAATTAGAATTGTTGG + Intergenic
1043899995 8:85768729-85768751 ATTAGTTGAATTAGAATTGTTGG + Intergenic
1043901600 8:85780922-85780944 ATTAGTTGAATTAGAATTGTTGG + Intergenic
1043901959 8:85784007-85784029 ATTAGTTGAATTAGAATTGTTGG + Intergenic
1043903567 8:85796197-85796219 ATTAGTTGAATTAGAATTGTTGG + Intergenic
1043905178 8:85808390-85808412 ATTAGTTGAATTAGAATTGTTGG + Intergenic
1043906790 8:85820581-85820603 ATTAGTTGAATTAGAATTGTTGG + Intergenic
1044581321 8:93829096-93829118 CTTATGTGATGCTGAGTTGTTGG + Intergenic
1044785799 8:95791247-95791269 ATTATTAGAAGTAGGATTGTGGG - Intergenic
1045217547 8:100163238-100163260 ATTTTTTGAAGCAGAATCGCTGG - Intronic
1045966806 8:108034279-108034301 TTTATTTGAATCAGAATCTTAGG - Intronic
1046069030 8:109228012-109228034 CTTATTTCAAACAGAATTTAAGG + Intergenic
1046557685 8:115795824-115795846 TTTATTTGGAGCAGTATTTTAGG + Intronic
1046795884 8:118371307-118371329 GTTAATTGAAGTAGAATTGAGGG + Intronic
1048103824 8:131385112-131385134 CTTATTTAAAGCACAGTTTTGGG - Intergenic
1051078441 9:13268342-13268364 TTTATTTGAATAAGAATTGAAGG - Intronic
1053298965 9:36935405-36935427 ATGATTTGCAGCAGAATTGAAGG + Intronic
1055433731 9:76271170-76271192 CTCATTTGATTCTGAATTGTGGG - Intronic
1057283860 9:93731762-93731784 CTTATTTGAGGCATAATTCCAGG - Intergenic
1057583943 9:96313014-96313036 TTTATTTGAAGCAGAATGTGGGG - Intergenic
1057705070 9:97390182-97390204 CTAATTTGAAGCAGAACTGCTGG + Intergenic
1058130744 9:101250186-101250208 GTTCTTTGAGGCAGAATGGTGGG - Intronic
1059083062 9:111270539-111270561 CCTATTTGATGCAGTTTTGTAGG - Intergenic
1059097999 9:111439614-111439636 CTTTTTTGAAGAAGCATTCTAGG + Intronic
1060580951 9:124746112-124746134 CTTATTAGAAACACAATTCTGGG + Intronic
1186204057 X:7182819-7182841 CTCATTGCAAGCAGAATTGATGG - Intergenic
1188184839 X:27100961-27100983 CTCATTTGAAGCATAATTGTTGG + Intergenic
1190950401 X:55138022-55138044 TTTATTTGAAGTAGAATTGCTGG - Intronic
1192866714 X:75141695-75141717 TTTCTTAGAAGTAGAATTGTTGG + Intronic
1196387819 X:115177424-115177446 CATATTTCAGGCAGAATTGGTGG - Intronic
1199250392 X:145655219-145655241 CCTACTTGATGCATAATTGTAGG - Intergenic
1199782689 X:151077148-151077170 ATTACTAGAAGCAGAATTGCTGG - Intergenic
1200071161 X:153530156-153530178 CTTGTTTGAATGAGAATTCTGGG + Intronic
1200431192 Y:3084584-3084606 CTTATTTGAAGTTGAAAGGTAGG - Intergenic
1201728018 Y:17175090-17175112 CTTGTTTAAATCACAATTGTTGG + Intergenic