ID: 1032652889

View in Genome Browser
Species Human (GRCh38)
Location 7:133898034-133898056
Sequence GAGGGTAGAACAGCGGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032652889 Original CRISPR GAGGGTAGAACAGCGGTTGC TGG (reversed) Intronic
902616589 1:17626784-17626806 CAGGGTAGAATGGTGGTTGCCGG - Intronic
903277690 1:22232310-22232332 AGGGCTAGAACAGCGGTTCCAGG - Intergenic
905109752 1:35586722-35586744 GAGGGTATCACAGAGGTTTCTGG + Intronic
905259204 1:36705735-36705757 GAGGGTGGAACAGAGGCAGCTGG + Intergenic
905854365 1:41298259-41298281 GAAGGCAGATCAGTGGTTGCAGG + Intergenic
907029113 1:51153276-51153298 GAGGGCAGAACTGCCCTTGCTGG + Intergenic
907598832 1:55746134-55746156 GAGGGTAGAACAGGTTTTGGTGG - Intergenic
907817994 1:57938785-57938807 GAGGGAAGGACAGTGGCTGCAGG - Intronic
908338833 1:63155348-63155370 GAGGGTAGAATGGAGGTTGGAGG + Intergenic
909321257 1:74288585-74288607 GAGAGTAGAATGGTGGTTGCCGG + Intronic
910305401 1:85757021-85757043 GAAAGTAGAACGGTGGTTGCAGG + Intronic
910951372 1:92652312-92652334 GAAAGTAGAACAGAGGTTACCGG + Intronic
916296339 1:163224229-163224251 GATAGTAGAACAGTGGTTACTGG - Intronic
918199480 1:182253823-182253845 GAGGCAAGAACTGAGGTTGCTGG + Intergenic
920290728 1:204921278-204921300 GAGAGTAAAACAGGAGTTGCTGG - Intronic
921046993 1:211484859-211484881 GAGGGTGGCACAGAGGTGGCTGG - Intronic
921319762 1:213927342-213927364 GAGGCTAGAAAAGCGGGTTCTGG - Intergenic
922877893 1:228954755-228954777 GAGGTAAGAACTGAGGTTGCTGG + Intergenic
1063299202 10:4836550-4836572 GAGGTTAGGACAGAGCTTGCTGG + Intronic
1064376236 10:14798973-14798995 GAGGGTAGAAAAGTGGTTGCTGG + Intergenic
1066054085 10:31664138-31664160 GAGGACAGATCAGTGGTTGCTGG + Intergenic
1067747908 10:48950223-48950245 GAAAGTAGAACAGTGGTTGCTGG - Intronic
1069555705 10:69396518-69396540 GAGAGTAGAATGGTGGTTGCTGG - Intronic
1069719846 10:70542453-70542475 GAAAGTAGAACAGGGGCTGCTGG - Intronic
1072918049 10:99552168-99552190 GAGAGTACAACAGTGGTTACCGG + Intergenic
1074871662 10:117581788-117581810 GAGGATGGAAATGCGGTTGCTGG + Intergenic
1075071522 10:119323112-119323134 GAGTGTAGGAGAGAGGTTGCCGG + Intronic
1075451507 10:122554922-122554944 GAGGGTAGCACAGAGGATCCGGG + Intergenic
1080533366 11:33198180-33198202 GAAAGTAGAACAGTGGTTACTGG - Intergenic
1084088803 11:66866890-66866912 GAGGGTTGCACAGTGGGTGCTGG + Intronic
1084120599 11:67066757-67066779 CAGGGTAGAACAGGGGCCGCAGG - Exonic
1086182241 11:83966907-83966929 GAGGATAAAACAGTGGTTACAGG - Intronic
1086730229 11:90240187-90240209 GAGTGTAGGACAGAGGGTGCAGG + Intergenic
1087109859 11:94453003-94453025 GAAGGTAGAATAGTGGTTACTGG - Intronic
1088798275 11:113283013-113283035 GAGGGTAAGTCAGGGGTTGCTGG + Intergenic
1089391607 11:118106040-118106062 GAGGGGAGAATAGCAGGTGCTGG - Intronic
1090078350 11:123593737-123593759 GAAGGCAGAACAGCAGTAGCTGG + Intronic
1090142354 11:124277979-124278001 GAGGGTAGACCAGCTCTTACTGG - Intergenic
1090858737 11:130634348-130634370 GAGAGTGGAACAGAGGCTGCAGG + Intergenic
1092473458 12:8798427-8798449 GAGAGTAGAATGGTGGTTGCAGG - Intergenic
1095709466 12:45273116-45273138 GAGAATAGAACAGTGATTGCCGG + Intronic
1095766150 12:45898245-45898267 GAAAGTAGAACAGTGGTTACTGG + Intronic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1101090296 12:101278546-101278568 GAGGATAGAGAAGTGGTTGCTGG - Intergenic
1101849645 12:108391998-108392020 CAGGGTAGAGCACAGGTTGCTGG + Intergenic
1103305992 12:119964394-119964416 GAAAGTAGAATGGCGGTTGCAGG - Intergenic
1104194542 12:126521417-126521439 GACAGTAGAATGGCGGTTGCAGG - Intergenic
1105840360 13:24248766-24248788 GTGGGTAGAACAGCAGTGGATGG + Intronic
1106961307 13:35001638-35001660 GAGAGTAGAATAGCAGTTCCTGG + Intronic
1108960056 13:56215364-56215386 GAAAGTAGAATAGTGGTTGCTGG + Intergenic
1110185613 13:72671546-72671568 GAAGGTAGATCAGCAGTTTCTGG + Intergenic
1110918028 13:81047478-81047500 GTGGGTAGGACAGGGGTTGAGGG + Intergenic
1111156520 13:84334896-84334918 GAGAGTACAATAGTGGTTGCAGG + Intergenic
1114584648 14:23799499-23799521 TAGGGGAGAAGGGCGGTTGCCGG - Intergenic
1115103390 14:29730820-29730842 GAGAGTAGAACAGTGGTTACTGG + Intronic
1118075618 14:62295545-62295567 GAGTGTAGAAGAGCGGTAGGGGG + Intergenic
1118497364 14:66321559-66321581 GAGAGTAGAACAGTGGTTGCTGG + Intergenic
1120794917 14:88622052-88622074 GAGAGTAGAATAGTGGTTACTGG - Exonic
1130038462 15:80382979-80383001 GAGAGTAGAACAACGGTTACCGG + Intronic
1130726377 15:86443625-86443647 GAGAGTAGAATAGCAGTTACCGG - Intronic
1134031017 16:10992307-10992329 GAGAGGAGAACAGTGGTTACAGG - Intronic
1135108868 16:19674733-19674755 GAGAGTAGAATGGTGGTTGCAGG - Intronic
1135977569 16:27119578-27119600 GAGAGTAGAACAGTAGTTACTGG - Intergenic
1136280285 16:29204516-29204538 GAGAGTAGAGCCGTGGTTGCCGG - Intergenic
1137390529 16:48077560-48077582 GAAAGTAGAATAGTGGTTGCAGG + Intergenic
1139456641 16:67084472-67084494 GACAGTAGAATAGTGGTTGCCGG + Intronic
1139770671 16:69273543-69273565 GAAGGTAGATTAGTGGTTGCCGG + Intronic
1140179145 16:72696384-72696406 GAGTGTTGGACAGCGGATGCAGG - Intergenic
1141453111 16:84118903-84118925 TGGGGTAGAACAGTGATTGCAGG + Intergenic
1141790853 16:86233093-86233115 GAGAGTAGAATGGCAGTTGCCGG + Intergenic
1142084645 16:88170458-88170480 GAGAGTAGAGCCGTGGTTGCTGG - Intergenic
1142690802 17:1605292-1605314 GAGGGGAAAACAGCAGCTGCAGG + Intronic
1144337431 17:14284141-14284163 GAGAGTAGAATGGGGGTTGCCGG + Intergenic
1144583223 17:16471884-16471906 GAGGGTAAAATGGCAGTTGCTGG + Intronic
1144643699 17:16954096-16954118 GAGGGAAGACCAGAGGTGGCTGG + Intronic
1145205091 17:20980287-20980309 GAGGGAAGACCAGAGGTGGCTGG - Intergenic
1147368624 17:39976000-39976022 GAGGGAAAAACAGCAGATGCTGG + Intronic
1149413196 17:56430340-56430362 GAGGGTAGAATAGCAGTAACCGG + Intronic
1150787718 17:68176232-68176254 GAGGGCAGAACTCCAGTTGCAGG + Intergenic
1150863786 17:68827909-68827931 GAGGGTAGAAAGGTGGTTACAGG - Intergenic
1151861308 17:76764426-76764448 GAGAGTAGCATAGTGGTTGCCGG - Intronic
1152305309 17:79516942-79516964 GAAGGTAGAATGGGGGTTGCTGG + Intergenic
1154490709 18:14919885-14919907 GGGGCTAGAACAGGGCTTGCAGG + Intergenic
1155275895 18:24187204-24187226 GAGAGTAGAATGGTGGTTGCCGG + Intronic
1155879014 18:31120755-31120777 GAGAGTAGAACAGTGGTTTCAGG - Intergenic
1158150715 18:54366307-54366329 GAGAGTAGAATAGTGGTTACCGG - Intronic
1159782286 18:72674143-72674165 GAGGGTAAAAGAGTGGTTACCGG - Intergenic
1160031971 18:75269828-75269850 GAAGGTAGAACGGTGGCTGCTGG - Intronic
1161082799 19:2319821-2319843 GAGGGATGAACAGCGGATGCAGG + Intronic
1162805821 19:13137504-13137526 GTTGGTAGAAGAGCGGATGCCGG - Exonic
1163228878 19:15985348-15985370 GAGAGTAGAACAGTGGTTACTGG + Intergenic
1165133117 19:33645599-33645621 GTGGGTGGAACAGCTGTTGGAGG + Intronic
1165137238 19:33677372-33677394 GATGGTAGAAAAGAGGCTGCAGG + Intronic
1168467978 19:56619335-56619357 GACGGTAGAACAGAGGATGCCGG - Intronic
925868673 2:8250864-8250886 GAGGGTGGAGCAGAGGTTGGAGG - Intergenic
926108273 2:10166013-10166035 GAGGGGAGCACAGCAGCTGCTGG + Intronic
927429314 2:23013565-23013587 GAGGGAAGCACAGTGGTTACAGG - Intergenic
927785791 2:25973817-25973839 AGGGGTAGAACAGCTGGTGCAGG + Intronic
928445892 2:31333058-31333080 GAGGGCAGGACAGAGGTTGTAGG - Intergenic
929277059 2:40037295-40037317 GAGGGTAGACGAGAGGTTGAGGG + Intergenic
930922852 2:56777854-56777876 GAGTGTCGAACAGTGGGTGCAGG - Intergenic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
932143724 2:69300921-69300943 GAAGGTAGAACAGAGGTTACCGG - Intergenic
932713494 2:74084958-74084980 GAAAGTAGAACAGTGGTTTCAGG + Intronic
933360495 2:81276768-81276790 GAGAGTAGAATGGTGGTTGCTGG + Intergenic
933535984 2:83575231-83575253 GAGGGTAGAACAGACATTGAAGG + Intergenic
933935068 2:87196890-87196912 GAGAATAGAGCAGGGGTTGCTGG + Intergenic
934043156 2:88146888-88146910 AAGGGTAGCAGAGAGGTTGCAGG - Intergenic
934616142 2:95772468-95772490 GAGGGGAGAACAGCAGAGGCAGG + Intergenic
934644756 2:96052092-96052114 GAGGGGAGAACAGCAGAGGCAGG - Intergenic
934838168 2:97608181-97608203 GAGGGGAGAACAGCAGAGGCAGG - Intergenic
935105992 2:100044215-100044237 GAGGGTAGAATGGAGGATGCGGG - Intronic
935985466 2:108668390-108668412 GAGAGTAAAATAGAGGTTGCTGG - Intronic
936358076 2:111769008-111769030 GAGAATAGAGCAGGGGTTGCTGG - Exonic
938262850 2:129907461-129907483 GAGGGTGGACCAGGGGATGCTGG + Intergenic
938555609 2:132421045-132421067 GATGTCAGAACAGAGGTTGCTGG + Intronic
939209790 2:139159298-139159320 GAGGGTAGATTAGTGGTTACCGG - Intergenic
940678299 2:156752310-156752332 GAGGTTGGACCAGCAGTTGCTGG - Intergenic
941680214 2:168390126-168390148 GAGAGTAGAACAGTGGTTACCGG + Intergenic
941949257 2:171136284-171136306 GAAAGTAGAATAGTGGTTGCTGG + Intronic
943492490 2:188572824-188572846 GAGAGTAGACTAGTGGTTGCTGG + Intronic
943791091 2:191933434-191933456 GAAGGTGGAACAGCTGTTGGAGG + Intergenic
943791102 2:191933471-191933493 GAAGGTGGAACAGCTGTTGGAGG + Intergenic
944768829 2:202891879-202891901 CAGAGTACAACAGTGGTTGCCGG + Intronic
945789417 2:214286142-214286164 GAGAGTAGAATGGTGGTTGCTGG + Intronic
947380446 2:229540298-229540320 GAGGGTGGAACTGGGGGTGCAGG + Intronic
948659621 2:239499000-239499022 GAGGGTTGAACCCCGGTGGCTGG + Intergenic
948891711 2:240910028-240910050 GAGGGGAGAGCAGCTGTGGCCGG - Intergenic
1169107373 20:3008449-3008471 GAAAGTAGAATAGTGGTTGCTGG + Intronic
1171401312 20:24874475-24874497 GAAGGAAGAACAGGGGGTGCAGG - Intergenic
1172611406 20:36255460-36255482 GCGGGTAGATCAGCTGCTGCTGG - Intronic
1174706937 20:52666587-52666609 GAGAGTAGAACAGTGTTTACGGG - Intergenic
1176140394 20:63542384-63542406 GAGGGTTGGACAGCAGGTGCGGG + Intronic
1178758407 21:35376019-35376041 GAGAGTAGAAAGGTGGTTGCCGG - Intronic
1180927991 22:19569356-19569378 AAGAGAAGAACAGCGGTTGTTGG + Intergenic
1181862361 22:25828911-25828933 GCTGGTAGAACAGCAGCTGCAGG - Exonic
1183206168 22:36420547-36420569 GAGAACAGAACAGCTGTTGCTGG + Intergenic
954677605 3:52324412-52324434 GAGGGGAGAACAGGGGCTCCAGG + Intronic
954698769 3:52441098-52441120 GAGGGTAGAAGAGTGGATGGTGG - Intronic
955045460 3:55355183-55355205 GAAAGTAGAATAGTGGTTGCTGG - Intergenic
955718481 3:61856325-61856347 GAAAGTAGATCAGTGGTTGCCGG - Intronic
960329164 3:116337134-116337156 GATGGTAGAATGGTGGTTGCAGG + Intronic
961648664 3:128406326-128406348 GAGGGTAGAAGGGTGGTTGTGGG + Intronic
963239978 3:142993214-142993236 GAAGGTAGAATGGAGGTTGCCGG + Intronic
965169952 3:165250240-165250262 GAGGTTAGAGAAGCAGTTGCTGG + Intergenic
965753491 3:172000856-172000878 GAAGGTAGAATAGAGGTTACTGG + Intergenic
965884012 3:173422336-173422358 GAGAGTAGAATGGCGGTTACCGG + Intronic
967359205 3:188610359-188610381 GTTGGTACCACAGCGGTTGCTGG + Intronic
972024827 4:34363391-34363413 GAGGCAAGAACTGAGGTTGCAGG - Intergenic
978210163 4:106125672-106125694 GAGAGTAGAACAGTAGTTGCTGG + Intronic
981490114 4:145330634-145330656 GAGAGCAGAACAGTTGTTGCTGG + Intergenic
986202878 5:5594654-5594676 GAGAGTAGAATGGTGGTTGCTGG + Intergenic
987769618 5:22283577-22283599 GAGGGTAGAATTGTGGTTGCTGG + Intronic
992404690 5:76445864-76445886 GAAAGTAGAATAGAGGTTGCTGG - Intronic
994215405 5:97131935-97131957 GAGGGTAGAAATGTGGTTGCTGG + Intronic
995879675 5:116830337-116830359 GAGGGTAGGACAGTGCCTGCTGG - Intergenic
999706635 5:154278720-154278742 GAAAGTAGAACAGAGGTTACAGG - Intronic
999890795 5:155976854-155976876 GATGGTAACACAGTGGTTGCAGG - Intronic
1000146155 5:158455118-158455140 GAGGCTAGAACTGCTGTTGGGGG - Intergenic
1000174690 5:158739901-158739923 GAGCTTAGAACAGCAATTGCCGG + Intronic
1003010888 6:2426567-2426589 GAGAGTAGAATAGTGGTTACCGG - Intergenic
1003410830 6:5861541-5861563 GAGAGTAGAATAGTGGTTACTGG + Intergenic
1005561204 6:27043398-27043420 GAGAGTAGAACAGTGGTTGCCGG + Intergenic
1007991025 6:46256067-46256089 GAGGTTAGAATAGGGGTTGGAGG + Intronic
1009621011 6:66077458-66077480 GAGGGTTGCACAGCGGGTGGAGG - Intergenic
1011236668 6:85226319-85226341 GAGGGTAGAATGGTGGTTGCTGG + Intergenic
1012965327 6:105667600-105667622 GGGGGTTGAGCAGGGGTTGCTGG - Intergenic
1013333460 6:109130223-109130245 GAAGGTAGAATGGTGGTTGCTGG - Intronic
1014296633 6:119626598-119626620 GAGAGTAGAACAGTGGTTCCAGG + Intergenic
1014656209 6:124107718-124107740 GAGGGTAGAATGGTGGTTGCTGG - Intronic
1021305505 7:19026731-19026753 AAGGGTAGAAGATCGCTTGCTGG - Intronic
1021630501 7:22640489-22640511 GAGAGTAAAACGGTGGTTGCCGG - Intergenic
1022378010 7:29833131-29833153 GAAAGTAGAACAGAGGTTACTGG + Intronic
1023220866 7:37919241-37919263 AAGAGTAGAACAGTGGTTCCTGG - Intronic
1023718500 7:43068676-43068698 GAAGGAAGATCAGAGGTTGCTGG - Intergenic
1023877884 7:44299350-44299372 GAAAGTAGAACAGAGGTTGCTGG + Intronic
1024605511 7:51019564-51019586 GAGTGGAGAACAGCATTTGCTGG + Intronic
1028469954 7:91195025-91195047 GAGCAAAGAACAGTGGTTGCAGG - Intronic
1029677814 7:102082651-102082673 AAGAGCAGAACAGCAGTTGCTGG - Intronic
1032652889 7:133898034-133898056 GAGGGTAGAACAGCGGTTGCTGG - Intronic
1036141116 8:6209390-6209412 GCAGGTTGAACAGAGGTTGCTGG + Intergenic
1038197806 8:25384246-25384268 GAAAGTAGATCAGTGGTTGCTGG + Intronic
1038579566 8:28735965-28735987 GAGAGTAGAATAGGGGCTGCCGG + Intronic
1039447512 8:37644540-37644562 GTGGCTAGAACATCGGTTCCTGG - Intergenic
1039453981 8:37696183-37696205 GAGTGGAGGACAGCGGCTGCAGG - Exonic
1040995935 8:53402367-53402389 GACAGTAGAACAGAGATTGCAGG - Intergenic
1043400876 8:79883075-79883097 GAGGGGAGAAAAGGGGTTTCAGG - Intergenic
1046354973 8:113070626-113070648 CAGGGTAGAATGGTGGTTGCCGG - Intronic
1048394278 8:133998954-133998976 GAAAGTAGAACAGTGGTTGCTGG - Intergenic
1049755654 8:144310275-144310297 GAGTGTGGGACAGCGGTTCCAGG - Intronic
1049999490 9:1061334-1061356 GAAAGTAGAAAGGCGGTTGCTGG - Intergenic
1050409269 9:5345300-5345322 GAGAATAGAACAGTGGTTACTGG + Intergenic
1050485205 9:6126840-6126862 GAGGGTATAACAGAGGTTTCAGG + Intergenic
1051723463 9:20064284-20064306 GAGAGTAGATCAATGGTTGCTGG + Intergenic
1051941354 9:22508873-22508895 GAGTGTAGGACAGAGGGTGCAGG - Intergenic
1052819845 9:33129842-33129864 GAGGGGAGAACAGAGGTGTCTGG + Intronic
1053166609 9:35848375-35848397 GCTGGTAGAACAGCTGTTGCTGG - Intronic
1057426854 9:94958066-94958088 GAAAGTAGAATGGCGGTTGCTGG - Intronic
1058037897 9:100273198-100273220 GAGGGAAGATGACCGGTTGCAGG - Intronic
1059246445 9:112853684-112853706 GAGAGTAGAACGGTGGTTGCCGG + Intronic
1060028797 9:120196215-120196237 GAGAGTAGAATAGTGGTTACAGG + Intergenic
1185502747 X:610922-610944 GAGGGTAGGAGAGGGGTTGAGGG - Intergenic
1187660009 X:21534114-21534136 GAGAGTAGAACTGTGGTTACTGG - Intronic
1190706826 X:53035814-53035836 GAGGGGAGAATTGAGGTTGCAGG - Intergenic
1191836246 X:65466177-65466199 GAGAGTAGAAGAGTGGTTACTGG - Intronic
1194350682 X:92822062-92822084 GAGGGTTGCACAGCGGCGGCCGG - Intergenic
1194634743 X:96331394-96331416 GAGAGTAGAATGGTGGTTGCTGG - Intergenic
1195012607 X:100747914-100747936 GAGAGTAGAATAGTGGTTGTTGG - Intergenic
1199376735 X:147121444-147121466 TAGGGTTTAACAGCGGATGCTGG + Intergenic
1199901677 X:152179456-152179478 GAGGGTAGAATGGTGGTTACTGG - Intronic
1200659012 Y:5938742-5938764 GAGGGTTGCACAGCGGCGGCCGG - Intergenic
1201975088 Y:19840101-19840123 GAGGGTTGGACAGTGGTTGCAGG - Intergenic