ID: 1032655946

View in Genome Browser
Species Human (GRCh38)
Location 7:133929714-133929736
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9283
Summary {0: 13, 1: 220, 2: 1105, 3: 2524, 4: 5421}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032655946 Original CRISPR GAGGGTGAAGGGTAGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr