ID: 1032660775 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:133981607-133981629 |
| Sequence | CTGGTAAGGTTGTGGAAAAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 6818 | |||
| Summary | {0: 1, 1: 35, 2: 483, 3: 1985, 4: 4314} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1032660771_1032660775 | 22 | Left | 1032660771 | 7:133981562-133981584 | CCAGTCAGAATAGCTATTATTAA | 0: 125 1: 1531 2: 4204 3: 5551 4: 20581 |
||
| Right | 1032660775 | 7:133981607-133981629 | CTGGTAAGGTTGTGGAAAAAAGG | 0: 1 1: 35 2: 483 3: 1985 4: 4314 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1032660775 | Original CRISPR | CTGGTAAGGTTGTGGAAAAA AGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||