ID: 1032660775

View in Genome Browser
Species Human (GRCh38)
Location 7:133981607-133981629
Sequence CTGGTAAGGTTGTGGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6818
Summary {0: 1, 1: 35, 2: 483, 3: 1985, 4: 4314}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032660771_1032660775 22 Left 1032660771 7:133981562-133981584 CCAGTCAGAATAGCTATTATTAA 0: 125
1: 1531
2: 4204
3: 5551
4: 20581
Right 1032660775 7:133981607-133981629 CTGGTAAGGTTGTGGAAAAAAGG 0: 1
1: 35
2: 483
3: 1985
4: 4314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032660775 Original CRISPR CTGGTAAGGTTGTGGAAAAA AGG Intronic
Too many off-targets to display for this crispr