ID: 1032662047

View in Genome Browser
Species Human (GRCh38)
Location 7:133994976-133994998
Sequence GTTGGCTTGTGAACTCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032662047_1032662051 -4 Left 1032662047 7:133994976-133994998 CCCTGAGGAGTTCACAAGCCAAC 0: 1
1: 0
2: 2
3: 16
4: 118
Right 1032662051 7:133994995-133995017 CAACTTTCTAGTAGAGCTCTGGG No data
1032662047_1032662050 -5 Left 1032662047 7:133994976-133994998 CCCTGAGGAGTTCACAAGCCAAC 0: 1
1: 0
2: 2
3: 16
4: 118
Right 1032662050 7:133994994-133995016 CCAACTTTCTAGTAGAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032662047 Original CRISPR GTTGGCTTGTGAACTCCTCA GGG (reversed) Intronic
900593859 1:3471660-3471682 GTTTGCCTCTGACCTCCTCAGGG + Intronic
903764792 1:25727351-25727373 GGTGATTTGAGAACTCCTCACGG + Intronic
906883922 1:49623747-49623769 GCTGGATTGTGAGCTCCTCAAGG + Intronic
907480880 1:54744886-54744908 GATGGCCTGGGAGCTCCTCAAGG - Intergenic
907490322 1:54805250-54805272 GATGGCTTGTGATCTTCCCAAGG - Intergenic
907839232 1:58140554-58140576 GTTCTCCTGTGAACTCCTAAAGG - Intronic
908395161 1:63718726-63718748 GTCGGATTGTGAACACCCCAGGG - Intergenic
909178938 1:72396071-72396093 GGTGACTTGTGAACACCTGAAGG - Intergenic
909935956 1:81550925-81550947 GTTTGGGTGTGAACTCCACAGGG + Intronic
915041818 1:152974159-152974181 GTTGCTTTGTGAACTTCTGAAGG - Intergenic
921313258 1:213866677-213866699 GTTGGCCTGAGAACTCTCCAGGG - Intergenic
923669759 1:236030270-236030292 GATGGCTTAGGAACTCCTCTTGG + Intronic
1065428449 10:25630079-25630101 GCTGGATTGTAAATTCCTCAAGG - Intergenic
1066590168 10:36986002-36986024 CTTGGCTTGTGAGATCCTCAAGG - Intergenic
1069915796 10:71785905-71785927 TTTGGCTAGTTAACTCCTCTTGG + Intronic
1077395392 11:2317998-2318020 GTTGACAAGTCAACTCCTCATGG + Exonic
1079119861 11:17674117-17674139 GTTAGTCTGTGAACTCCTTAAGG + Intergenic
1081079633 11:38725880-38725902 GTTGGCTTCTGAAGTTCTGAGGG + Intergenic
1082601853 11:55168088-55168110 GTTGGCGTGGCAATTCCTCAGGG - Intergenic
1085295521 11:75429577-75429599 ACTGGCTTGTTAACTCTTCAAGG + Intronic
1085897914 11:80662019-80662041 CTTGGCTTGTGAGATCCTCAAGG + Intergenic
1087682600 11:101233124-101233146 GATGGCTTGTCCACTTCTCACGG - Intergenic
1091263421 11:134252232-134252254 GTGGGCCTGTTAACTCCTAAGGG - Intronic
1091850717 12:3694553-3694575 GTTGGCTTGTCACTTCCACATGG - Intronic
1092123566 12:6060749-6060771 GTTGGCTTCTCTTCTCCTCAGGG + Intronic
1093346004 12:18038817-18038839 GATGGCTTGTCCACTTCTCAGGG + Intergenic
1096655292 12:53086824-53086846 GCTGGCTTATGAACTCCTTAAGG - Intergenic
1098146363 12:67501707-67501729 GTTGGATTGTAAACTCTTTAAGG + Intergenic
1103670152 12:122607537-122607559 GTTGTGTTGTGCCCTCCTCAGGG + Intronic
1107189645 13:37564532-37564554 GTTGGCTTGCAACTTCCTCACGG + Exonic
1108496734 13:51033036-51033058 GTTATCATGTGAACTACTCAAGG - Intergenic
1111522023 13:89417637-89417659 GTTGTTTTGTGATCACCTCATGG + Intergenic
1112124611 13:96450897-96450919 TGTGGCTTGTGAAGTCCTAATGG + Intronic
1116701588 14:48251114-48251136 GTGGGCTTTAGAACTCCACAAGG + Intergenic
1121270409 14:92633999-92634021 GTCAGCTTGTGAACTTCCCAGGG - Intronic
1125002859 15:34789437-34789459 GTAGGTGTGTGAACTCCTCGAGG + Exonic
1125163967 15:36680621-36680643 CTTGGGTTTTGAACTCCCCAGGG + Intronic
1129413112 15:75360687-75360709 CTAGGCTTGTGGTCTCCTCAGGG - Exonic
1131619900 15:94057042-94057064 TTTGAATTCTGAACTCCTCAAGG - Intergenic
1135160874 16:20095068-20095090 ACTGGATTGTGAACTCCTCCTGG - Intergenic
1139488085 16:67270742-67270764 GTGGGCTTGGGCACACCTCAAGG - Exonic
1141950123 16:87334639-87334661 TTTGGCTCCTGGACTCCTCACGG - Intronic
1146311248 17:31770090-31770112 GATGGCTTGTCCACTTCTCAGGG + Intergenic
1146587866 17:34098130-34098152 GCTGGACTGTGAATTCCTCAGGG - Intronic
1151413984 17:73949604-73949626 GTTGGGCTGTGAACTCTTGAAGG - Intergenic
1152664183 17:81557880-81557902 GTTGGCTTCTGAAGTGGTCAGGG - Exonic
1152751466 17:82064390-82064412 GGTGGCTTGGGGACTCCTCCCGG - Intronic
1153493311 18:5671822-5671844 CTTGGATTGTGAACTCCTTGAGG + Intergenic
1153973239 18:10245448-10245470 GTTGGCTTGTTTACCCCTCAGGG + Intergenic
1155022214 18:21906998-21907020 GTTTCCCTGTGAGCTCCTCAGGG + Intergenic
1156164059 18:34396759-34396781 GTTGGTTTCTGAGCTCCTCTTGG + Intergenic
1159841185 18:73401028-73401050 ATTGGCTTATGAACATCTCATGG - Intergenic
1160259171 18:77275119-77275141 GTTGGCATGTGGCCTCCTGAGGG + Exonic
1163115374 19:15185678-15185700 GATTGCTTGTGTACTCCCCAGGG - Exonic
1165212390 19:34246407-34246429 GTTGGCTTGTGCATTCTTTATGG - Intergenic
926574128 2:14561667-14561689 GTTAGGTTGTCAACTCCTCAGGG - Intergenic
928376840 2:30781944-30781966 GTTGGCTTCTGTATTACTCAGGG - Intronic
937119328 2:119431235-119431257 GTTTCCTCCTGAACTCCTCAGGG - Intronic
938936686 2:136133429-136133451 GATCACTTGTGCACTCCTCAGGG - Intergenic
939164792 2:138628860-138628882 GATAGGCTGTGAACTCCTCAAGG + Intergenic
939479768 2:142733432-142733454 GTTGGTGTGGGAATTCCTCAGGG + Intergenic
944534550 2:200696221-200696243 ATTGGCCTGTGAGCTCCTTAGGG - Intergenic
946007845 2:216540808-216540830 GCTGGCCTGGGAGCTCCTCAAGG + Intronic
948540100 2:238685027-238685049 ATTGGCTTGTGAACTTGTCAAGG - Intergenic
1170405188 20:16028298-16028320 GCTGGCTTGTGAACTCCATGAGG + Intronic
1170616722 20:17959136-17959158 GTGAGCCTGTGAACTCCACATGG + Intronic
1171429787 20:25075305-25075327 GTTGCCTTGTCAACTCCTCTGGG - Intronic
1172831866 20:37842762-37842784 GCTGGCTTCTGAAATCCTGAAGG + Intronic
1174133292 20:48360699-48360721 GTGGCCTGCTGAACTCCTCAAGG - Intergenic
1175201405 20:57280274-57280296 GTTGGTTTGTGAGCTCCTAGAGG + Intergenic
1176364128 21:6022374-6022396 GTGGGCTTGTGTCCTCCTCATGG + Intergenic
1179759390 21:43516171-43516193 GTGGGCTTGTGTCCTCCTCATGG - Intergenic
1181689660 22:24551521-24551543 GTTAACCTGTGAACTCATCAAGG + Intronic
1182065960 22:27431792-27431814 GCTGGTTTGTCAACCCCTCATGG + Intergenic
950783619 3:15413821-15413843 GAAGGCTTGTGAGCTCTTCAAGG + Intronic
953675714 3:45000344-45000366 GTTGAACTGTGAACTCCTAAAGG - Intronic
956788135 3:72659863-72659885 GGAGGCTTGGGAACTCCTCCTGG + Intergenic
956817154 3:72918244-72918266 GTTGGCTTGTGTACTCTTTGTGG + Intronic
956868997 3:73397952-73397974 AATGGCTTGTGAGCTCCTTAAGG + Intronic
958715990 3:97781108-97781130 GTGGAAGTGTGAACTCCTCAAGG + Intronic
960489946 3:118304763-118304785 GTTGGCTTTTGTAATCCACATGG + Intergenic
962450736 3:135514426-135514448 GTTGGATTATGAAGTCCTCCAGG - Intergenic
962514392 3:136136570-136136592 ATTAGATTGTGAGCTCCTCAGGG + Intronic
970767531 4:19567712-19567734 TGTGGGTTGTGGACTCCTCAGGG - Intergenic
970858652 4:20676901-20676923 TCTGGCTGGTGAATTCCTCAGGG + Intergenic
972203231 4:36740850-36740872 GTTGGCTTGAGAAAGCCTAAAGG + Intergenic
975655673 4:76639090-76639112 GTTGACTTGTGACTGCCTCAAGG - Intronic
976379324 4:84381483-84381505 TTTAGCTGGTGATCTCCTCAGGG + Intergenic
976630237 4:87228973-87228995 GTTGGCTTTTAAACTCCCAAGGG - Intronic
977884906 4:102243619-102243641 GATGGCTTGTCCACTTCTCAGGG + Intergenic
978662426 4:111143775-111143797 GTTTAATTGTGAACTCATCAAGG + Intergenic
981892570 4:149755565-149755587 GGTGGCTGGTGAAGGCCTCATGG - Intergenic
983479810 4:168259076-168259098 GTTGGGTTTTCAACTCCTTATGG + Intronic
984355978 4:178658131-178658153 TTTGGCTTGTGAACTCTTTAGGG + Intergenic
984830711 4:183970402-183970424 GTTGGGTTGGGTGCTCCTCAGGG + Intronic
987818573 5:22933620-22933642 GATGGCTTGTCCACTTCTCAGGG + Intergenic
988534159 5:32051180-32051202 GTTTGTGTGTGAACTCCTAAGGG - Intronic
991547487 5:67799759-67799781 CTTGGCTTGGAAACTTCTCAAGG - Intergenic
992050101 5:72933841-72933863 GATGGCTTGTCCACTTCTCAGGG + Intergenic
993344194 5:86762140-86762162 GTTGTCTAGTGGACTCCTCAAGG + Intergenic
995707148 5:114997920-114997942 GATGGCTTGTCCACTTCTCAGGG + Intergenic
997073029 5:130640566-130640588 GATGGCTTGTCCACTTCTCAAGG + Intergenic
998708719 5:144796186-144796208 GTTTGTCTGTGAACTCCTGAAGG + Intergenic
999116343 5:149167157-149167179 ATTATCTTGTGGACTCCTCAAGG - Intronic
999908515 5:156170025-156170047 ATTGGCTAGTAAACTCCTGAGGG + Intronic
1001365062 5:171129025-171129047 CTTTAGTTGTGAACTCCTCAAGG + Intronic
1005266020 6:24112980-24113002 GTTAGCTTGTGAGCTCCTCAAGG - Intergenic
1010522491 6:76856253-76856275 GTTGGATTGTAAATTCCTCAGGG - Intergenic
1013189197 6:107787779-107787801 GTGGGGTTGTGAATTCTTCAAGG + Intronic
1019089074 6:169510213-169510235 GTTGGCGTGGCAATTCCTCAGGG + Intronic
1019530332 7:1499928-1499950 GCTGGCCTGTAACCTCCTCATGG - Exonic
1019812694 7:3176017-3176039 ATTGGCTTTTGAACTTCTTAAGG + Intergenic
1020728922 7:11855647-11855669 GTTTGCTTCAGAATTCCTCACGG + Intergenic
1020903401 7:14034239-14034261 GTTAGCTTGTGAATTCCCTAAGG + Intergenic
1023119467 7:36894750-36894772 GCTGTGTTGTGAGCTCCTCAGGG - Intronic
1024045319 7:45581663-45581685 GTGGTCGTGTGAACTCCACAAGG - Intronic
1024603858 7:51009443-51009465 AATGGCTTGTGAACTCCACTTGG + Intergenic
1027496462 7:78893312-78893334 GTTGGTGTGGGAATTCCTCAGGG + Intronic
1028433602 7:90776282-90776304 GTTAGCTGGTAATCTCCTCAAGG + Intronic
1032662047 7:133994976-133994998 GTTGGCTTGTGAACTCCTCAGGG - Intronic
1035443862 7:158926168-158926190 GTGGGCTTTTGAACTCCAGATGG + Exonic
1039692465 8:39877859-39877881 GATGGCTTGTCTACTTCTCAGGG - Intergenic
1039829669 8:41202732-41202754 GTTGGCTAGTAATCTTCTCAGGG + Intergenic
1040072757 8:43201748-43201770 GTTGGTTTCTGTATTCCTCATGG + Exonic
1040602142 8:48896133-48896155 ATTGGCTTGTCAGCTCCGCAGGG - Intergenic
1041353518 8:56974568-56974590 GTTTGCTTGTGCCCTCCTCCTGG - Intronic
1042969742 8:74395026-74395048 GCTGGCCTGTAAACTTCTCATGG + Intronic
1043254389 8:78115416-78115438 GGTGGATTGTGAACTCCTCAAGG - Intergenic
1043978536 8:86610638-86610660 GTTCGCTTGTGAACTCACCAAGG + Intronic
1049171035 8:141160813-141160835 GCTGGCTGGTTACCTCCTCATGG - Intronic
1057475136 9:95393326-95393348 ATTGGCTTTTGAACTCTTCAAGG + Intergenic
1057868456 9:98700136-98700158 GTTGGACAGTGAGCTCCTCAAGG + Intronic
1058937546 9:109782943-109782965 GCAGGCTTGTGATCTCCTCAGGG - Intronic
1062279273 9:135744738-135744760 TTTGGCCTGTGGATTCCTCAGGG + Intronic
1186990775 X:15064811-15064833 TTGGGATTGTGAATTCCTCAAGG - Intergenic
1198832607 X:140766056-140766078 TTTGGCTTGATACCTCCTCAAGG - Intergenic
1201468860 Y:14313043-14313065 GATGGCTTGTCCACTTCTCAAGG + Intergenic