ID: 1032662048

View in Genome Browser
Species Human (GRCh38)
Location 7:133994977-133994999
Sequence AGTTGGCTTGTGAACTCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032662048_1032662050 -6 Left 1032662048 7:133994977-133994999 CCTGAGGAGTTCACAAGCCAACT 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1032662050 7:133994994-133995016 CCAACTTTCTAGTAGAGCTCTGG No data
1032662048_1032662051 -5 Left 1032662048 7:133994977-133994999 CCTGAGGAGTTCACAAGCCAACT 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1032662051 7:133994995-133995017 CAACTTTCTAGTAGAGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032662048 Original CRISPR AGTTGGCTTGTGAACTCCTC AGG (reversed) Intronic
908034825 1:60040663-60040685 GGTTTGTCTGTGAACTCCTCAGG + Intronic
909935955 1:81550924-81550946 AGTTTGGGTGTGAACTCCACAGG + Intronic
912718931 1:112003504-112003526 AGGTGGCCTGTGCAGTCCTCTGG + Intergenic
915706614 1:157849869-157849891 AGTTTGCTTGAGATTTCCTCTGG + Intronic
915857255 1:159402359-159402381 AGTTGTCTTGTGAAGTCTTTAGG - Intergenic
922613352 1:226945877-226945899 AGCTGGCTTGGAAACTCATCTGG + Intronic
1071214638 10:83385968-83385990 AGTTTTCTTGTGGAATCCTCAGG + Intergenic
1075584773 10:123649775-123649797 AGCTTGCTTGTCAACTCCTCGGG + Intergenic
1081079632 11:38725879-38725901 AGTTGGCTTCTGAAGTTCTGAGG + Intergenic
1082601854 11:55168089-55168111 AGTTGGCGTGGCAATTCCTCAGG - Intergenic
1089791354 11:120946912-120946934 AGCTGGCTTGGGACCTTCTCTGG - Intronic
1090880964 11:130831088-130831110 ACATGGCTCCTGAACTCCTCTGG + Intergenic
1091263422 11:134252233-134252255 AGTGGGCCTGTTAACTCCTAAGG - Intronic
1092123565 12:6060748-6060770 AGTTGGCTTCTCTTCTCCTCAGG + Intronic
1092346678 12:7721202-7721224 AGTTGCCTTTTGAACCCCTGGGG - Intergenic
1092574770 12:9769317-9769339 AGGTGACTTGTGAAATCATCTGG + Intergenic
1093346003 12:18038816-18038838 AGATGGCTTGTCCACTTCTCAGG + Intergenic
1102075820 12:110059259-110059281 AGTTTTCTTGTGAATTCTTCGGG + Intronic
1103670151 12:122607536-122607558 AGTTGTGTTGTGCCCTCCTCAGG + Intronic
1110001802 13:70212264-70212286 ATTTGGCTTGTGAATCCATCTGG - Intergenic
1117792555 14:59356450-59356472 ATTTGGCTTGTGTACTTCACAGG - Intronic
1119767159 14:77197436-77197458 AGCTGGGTTGTGAACCCATCTGG - Intronic
1122135436 14:99630165-99630187 AATTGGATTCTGAGCTCCTCCGG - Intergenic
1122465323 14:101929646-101929668 AGTTGCCTTGAGAAATGCTCTGG + Intergenic
1122950115 14:105039496-105039518 AGGTGGGTTGGGAACTCCTGGGG - Intergenic
1129305917 15:74662298-74662320 TGTTGGCTTATAAACTCCTTGGG - Intronic
1131069894 15:89459639-89459661 AGTGGCCTTGTGAACACCTGTGG + Intergenic
1131106078 15:89735902-89735924 TGTTGCCTTCTCAACTCCTCTGG - Intronic
1131848508 15:96513392-96513414 TGTTGGCTTGGGAACTAATCAGG + Intergenic
1137399987 16:48145546-48145568 AGCTGGCTTGTGATCTGCTTTGG + Intronic
1137861461 16:51850839-51850861 AGCTGACCTGTGACCTCCTCTGG + Intergenic
1138537766 16:57668761-57668783 AGCTGGCTTGTGAGATCCTGGGG + Intronic
1141365844 16:83442082-83442104 AGTTGGCCTGTGTGTTCCTCCGG - Intronic
1142069260 16:88081497-88081519 AGTTTGCTTGTGAGTTCCTTTGG - Intronic
1144480923 17:15628501-15628523 AGCTGGCTTTTGAAATCCTATGG - Exonic
1144917439 17:18735552-18735574 AGCTGGCTTTTGAAATCCTATGG + Exonic
1146311247 17:31770089-31770111 AGATGGCTTGTCCACTTCTCAGG + Intergenic
1147811356 17:43171971-43171993 ACTTGGCTTGTAAAGGCCTCTGG + Intronic
1153309423 18:3663473-3663495 AGTGGGCTTGTGGACTGCTTTGG + Intronic
1153708965 18:7778195-7778217 AGCTGGCTTGATAACTACTCTGG + Intronic
1153973238 18:10245447-10245469 TGTTGGCTTGTTTACCCCTCAGG + Intergenic
1154063794 18:11087809-11087831 AGTGGGCTTGTGCACTGCACAGG + Intronic
1155022213 18:21906997-21907019 AGTTTCCCTGTGAGCTCCTCAGG + Intergenic
1156539655 18:37897187-37897209 ATTTGGTTTGTGAAGTCCTAAGG + Intergenic
1160259170 18:77275118-77275140 AGTTGGCATGTGGCCTCCTGAGG + Exonic
1163115375 19:15185679-15185701 AGATTGCTTGTGTACTCCCCAGG - Exonic
1163327500 19:16614619-16614641 AGTGGCCTGGTGAACCCCTCAGG - Intronic
1163516981 19:17770702-17770724 ACCTGGCAGGTGAACTCCTCGGG - Intronic
1164812301 19:31166805-31166827 ATGTGGCTTGTGAGCTCCTGTGG - Intergenic
1165828688 19:38719888-38719910 AGCTGGCTTCTAAACACCTCAGG - Intronic
925650722 2:6086427-6086449 TGTTGACTTGTGAACTCAACAGG - Intergenic
926574129 2:14561668-14561690 CGTTAGGTTGTCAACTCCTCAGG - Intergenic
927759241 2:25737054-25737076 ACTTGAATTTTGAACTCCTCTGG - Intronic
928538074 2:32259040-32259062 AGTTGGCTTGGGAACTCATGTGG + Intronic
928721470 2:34126098-34126120 AGTTGGCTTGTTGAGTCTTCTGG + Intergenic
933573262 2:84038451-84038473 AGTTGGCATCTGAACTTCTGAGG - Intergenic
936628663 2:114176233-114176255 AGTTAGACTGTGCACTCCTCAGG - Intergenic
939479767 2:142733431-142733453 AGTTGGTGTGGGAATTCCTCAGG + Intergenic
939909554 2:147963164-147963186 AGTTGGCAAGTGTACTTCTCAGG - Intronic
940312782 2:152295955-152295977 TGTTGTCTTGTGAACTTCTAAGG + Intergenic
940971610 2:159902790-159902812 TGTTGGCTGGTGAAAACCTCAGG + Intronic
942034172 2:171994811-171994833 AGTTGGCTTGGGAACTGTGCAGG - Intronic
947448085 2:230179919-230179941 AGTTGGCTTTGGAAGTCCTCGGG - Intronic
947892140 2:233633414-233633436 AGTTCGGCTGTGAACTCATCTGG + Intronic
1170509236 20:17059770-17059792 TGTTGTCTTGTGTAATCCTCAGG + Intergenic
1171127041 20:22611393-22611415 AGTTCCCTGGTGAACTTCTCTGG + Intergenic
1171429788 20:25075306-25075328 TGTTGCCTTGTCAACTCCTCTGG - Intronic
1173577553 20:44123001-44123023 AGCTGGGTTGAGGACTCCTCAGG + Intronic
1174661739 20:52219700-52219722 AGGTGGCTTGTGGGCTGCTCTGG - Intergenic
1174988470 20:55482311-55482333 AGGTGTCTTGTGCACTCCTTTGG - Intergenic
1178355736 21:31909380-31909402 AAGTGGCTTGAGAACTCCCCTGG + Intronic
1184899442 22:47435366-47435388 AGGTGGCTTGTGATTTCTTCAGG - Intergenic
952736480 3:36696366-36696388 AGTTTGCTTGTCAACTCTCCAGG - Intergenic
953805166 3:46062163-46062185 AGATGGTTTCTGAACTCCTTGGG + Intergenic
954651027 3:52162735-52162757 AGTTGGGGTGGGAGCTCCTCAGG - Intergenic
956208661 3:66780273-66780295 AGCTGGCTTCTGAACTCTTGAGG + Intergenic
960080903 3:113539317-113539339 AGTTGGCTCCTGAATTCTTCTGG + Intronic
969409753 4:7020110-7020132 GGTTGGTATGTGAACTCCTCTGG + Intronic
976379323 4:84381482-84381504 ATTTAGCTGGTGATCTCCTCAGG + Intergenic
977884905 4:102243618-102243640 AGATGGCTTGTCCACTTCTCAGG + Intergenic
981359093 4:143827006-143827028 AGTTGGCTTGTGAATTTCAGAGG - Intergenic
981369876 4:143947908-143947930 AGTTGGCTTGTGAATTTCAGAGG - Intergenic
981379618 4:144057866-144057888 AGTTGGCTTGTGAATTTCAGAGG - Intergenic
984355977 4:178658130-178658152 CTTTGGCTTGTGAACTCTTTAGG + Intergenic
984370110 4:178852956-178852978 AGTTGGATTTTGAACTGCTTTGG - Intergenic
984830710 4:183970401-183970423 AGTTGGGTTGGGTGCTCCTCAGG + Intronic
986438352 5:7757479-7757501 ATGTGGCTTTTGAAGTCCTCGGG + Exonic
987478579 5:18423941-18423963 AATTCGCTAGTGAACCCCTCAGG - Intergenic
987818572 5:22933619-22933641 AGATGGCTTGTCCACTTCTCAGG + Intergenic
990113289 5:52354976-52354998 TCTTGGTTTGTAAACTCCTCAGG + Intergenic
992050100 5:72933840-72933862 AGATGGCTTGTCCACTTCTCAGG + Intergenic
992453836 5:76897873-76897895 AGTTTTCTTGTGGACTCCTTAGG + Intronic
992470626 5:77049352-77049374 TCTTGGGTTGTGAAATCCTCCGG - Intronic
995198780 5:109403410-109403432 AGTTTGCATGTGAACTCTTCTGG - Intronic
995707147 5:114997919-114997941 AGATGGCTTGTCCACTTCTCAGG + Intergenic
999547337 5:152644412-152644434 TGTTGGTATGTGACCTCCTCTGG + Intergenic
1001820948 5:174709933-174709955 AGTTGCCTTGTGAAGTCCCTTGG + Intergenic
1003642854 6:7889959-7889981 AGCTGGCATGTGAACTGGTCTGG - Intronic
1006672087 6:35735840-35735862 AGGCGGCTTGTGAGGTCCTCTGG - Intergenic
1007324564 6:41050056-41050078 AGTGGGCTTGTGAAGACCACAGG - Intronic
1007685570 6:43665497-43665519 AGTTGGCAAGTGAATTCATCAGG + Intronic
1010522492 6:76856254-76856276 TGTTGGATTGTAAATTCCTCAGG - Intergenic
1012805193 6:103884751-103884773 ATTTGACTCGTGAACTGCTCTGG - Intergenic
1015816231 6:137213876-137213898 AGATGGGTGATGAACTCCTCGGG - Intronic
1016572476 6:145530702-145530724 AGGTGGATTGTAAACTCCTTGGG - Intronic
1016813522 6:148283017-148283039 AGTTGGCTTGGGATCACTTCAGG - Intronic
1019089073 6:169510212-169510234 AGTTGGCGTGGCAATTCCTCAGG + Intronic
1022044648 7:26613228-26613250 AGTTGGATTGTGAGTTCCTTGGG - Intergenic
1027496461 7:78893311-78893333 AGTTGGTGTGGGAATTCCTCAGG + Intronic
1028861426 7:95655819-95655841 ATTTGGATTGTGAAATCCTCAGG - Intergenic
1030070395 7:105693129-105693151 AATTGTTTTCTGAACTCCTCAGG - Intronic
1030509630 7:110468849-110468871 AGTTGGCTTATGAATTCCTTAGG - Intergenic
1032662048 7:133994977-133994999 AGTTGGCTTGTGAACTCCTCAGG - Intronic
1035233241 7:157479127-157479149 AGTTGGCCTGTGAACAGCACAGG - Intergenic
1039692466 8:39877860-39877882 AGATGGCTTGTCTACTTCTCAGG - Intergenic
1039829668 8:41202731-41202753 AGTTGGCTAGTAATCTTCTCAGG + Intergenic
1042658041 8:71122085-71122107 AGTTCACCAGTGAACTCCTCTGG + Intergenic
1046065446 8:109191229-109191251 AGTAGGATTATGAATTCCTCAGG + Intergenic
1046901489 8:119528370-119528392 AGTTTGCTTGTGGAGTCTTCTGG - Intergenic
1048822322 8:138391558-138391580 AGCTGGCTTGAGAAGTCATCTGG - Intronic
1058937547 9:109782944-109782966 GGCAGGCTTGTGATCTCCTCAGG - Intronic
1059765158 9:117377134-117377156 AGAGGTCTTTTGAACTCCTCGGG + Intronic
1189934134 X:46048538-46048560 AATTTACTTGTGAACTCATCTGG - Intergenic
1195727013 X:107928477-107928499 AGTTGGCTTCGGAAGTCTTCTGG + Intergenic
1196599617 X:117586524-117586546 AGTTTTCTTGTGAAGTCTTCAGG + Intergenic
1199388109 X:147246947-147246969 ACTAGGCTTGTGATCTCATCTGG - Intergenic
1201404419 Y:13635528-13635550 AGATGGCTTGTCCACTTCTCAGG + Intergenic