ID: 1032662050

View in Genome Browser
Species Human (GRCh38)
Location 7:133994994-133995016
Sequence CCAACTTTCTAGTAGAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032662048_1032662050 -6 Left 1032662048 7:133994977-133994999 CCTGAGGAGTTCACAAGCCAACT 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1032662050 7:133994994-133995016 CCAACTTTCTAGTAGAGCTCTGG No data
1032662047_1032662050 -5 Left 1032662047 7:133994976-133994998 CCCTGAGGAGTTCACAAGCCAAC 0: 1
1: 0
2: 2
3: 16
4: 118
Right 1032662050 7:133994994-133995016 CCAACTTTCTAGTAGAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032662050 Original CRISPR CCAACTTTCTAGTAGAGCTC TGG Intronic
No off target data available for this crispr