ID: 1032675533

View in Genome Browser
Species Human (GRCh38)
Location 7:134126982-134127004
Sequence ATGTCTCTAAAGCAGTCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032675533_1032675534 5 Left 1032675533 7:134126982-134127004 CCTACAGACTGCTTTAGAGACAT No data
Right 1032675534 7:134127010-134127032 ACTTCTAAAGTACGACTCTGCGG No data
1032675533_1032675537 30 Left 1032675533 7:134126982-134127004 CCTACAGACTGCTTTAGAGACAT No data
Right 1032675537 7:134127035-134127057 AGAGCCCTTTGGGAATGAAGCGG No data
1032675533_1032675535 19 Left 1032675533 7:134126982-134127004 CCTACAGACTGCTTTAGAGACAT No data
Right 1032675535 7:134127024-134127046 ACTCTGCGGAAAGAGCCCTTTGG No data
1032675533_1032675536 20 Left 1032675533 7:134126982-134127004 CCTACAGACTGCTTTAGAGACAT No data
Right 1032675536 7:134127025-134127047 CTCTGCGGAAAGAGCCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032675533 Original CRISPR ATGTCTCTAAAGCAGTCTGT AGG (reversed) Intergenic
No off target data available for this crispr