ID: 1032678171

View in Genome Browser
Species Human (GRCh38)
Location 7:134152012-134152034
Sequence TAAGACCTCCAAAATAATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 237}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032678171_1032678174 12 Left 1032678171 7:134152012-134152034 CCATCATTATTTTGGAGGTCTTA 0: 1
1: 0
2: 3
3: 24
4: 237
Right 1032678174 7:134152047-134152069 AAACAAGAGAAAGAAATTAAAGG 0: 1
1: 81
2: 1480
3: 5333
4: 10092
1032678171_1032678176 29 Left 1032678171 7:134152012-134152034 CCATCATTATTTTGGAGGTCTTA 0: 1
1: 0
2: 3
3: 24
4: 237
Right 1032678176 7:134152064-134152086 TAAAGGTGTAAAGGTTAGTAAGG No data
1032678171_1032678175 20 Left 1032678171 7:134152012-134152034 CCATCATTATTTTGGAGGTCTTA 0: 1
1: 0
2: 3
3: 24
4: 237
Right 1032678175 7:134152055-134152077 GAAAGAAATTAAAGGTGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032678171 Original CRISPR TAAGACCTCCAAAATAATGA TGG (reversed) Intronic
904936482 1:34133304-34133326 CAAGCCTTGCAAAATAATGATGG + Intronic
906456111 1:45998632-45998654 TAAGACCTCCAGGAAAATTATGG + Intronic
908072635 1:60479569-60479591 CAAGACCTACAAAGAAATGAAGG + Intergenic
908652932 1:66355912-66355934 TAAGACCTCTGAAGTAATGAGGG + Intronic
909126388 1:71676225-71676247 AATAACTTCCAAAATAATGATGG - Intronic
909398356 1:75195783-75195805 TGAGACTTCCAAAATGATGGAGG - Intergenic
911350360 1:96746400-96746422 TAAGACCTCATTAATAATCAGGG - Intronic
913142748 1:115957357-115957379 GAAAACCTGCAAAATAATCATGG + Intergenic
914199539 1:145472583-145472605 GAAGAGCTCCAAATTAATAAAGG - Intergenic
914380265 1:147109383-147109405 ACAGCCCTCCAAAATAATGGGGG + Intergenic
914478652 1:148045716-148045738 GAAGAGCTCCAAATTAATAAAGG - Intergenic
914515091 1:148367565-148367587 TAAGAACTCCACATTAATAAAGG - Intergenic
915161844 1:153925871-153925893 TAATACCTTCAAAATACTCAGGG + Intergenic
916192742 1:162194901-162194923 CAGGTCCTCCAAAATAATGCTGG - Intronic
916369636 1:164076289-164076311 TAAGAACTGCAAAAGAAAGAGGG - Intergenic
916654734 1:166864665-166864687 TAAGAATTTCAAGATAATGATGG + Intronic
916826566 1:168447600-168447622 TAGGACGTCGATAATAATGATGG - Intergenic
917018507 1:170561104-170561126 TAAGGCCTCAAAAATATTTAAGG - Intergenic
918879625 1:190099951-190099973 TAAAACCAGTAAAATAATGAGGG + Intronic
920316617 1:205080302-205080324 TGAGACCTCAAAAATAAAGAGGG + Intergenic
920641798 1:207759573-207759595 TAAGACACACATAATAATGAAGG - Intronic
920976358 1:210789301-210789323 CCAAACCTCTAAAATAATGAGGG + Intronic
921477891 1:215632405-215632427 TAACATCTCCACAAGAATGATGG + Intronic
922013320 1:221615090-221615112 TAGGACCTCTTAAATAATGTGGG + Intergenic
922192859 1:223334662-223334684 TAATGCCTTCAAAATTATGAGGG + Intronic
923952497 1:238974140-238974162 CAGGACCTCCAATATATTGATGG + Intergenic
924122658 1:240817904-240817926 TAAGAGCACCAAAAAAAGGACGG - Intronic
924540086 1:244971849-244971871 TAATACCTACAAAATAATCCTGG - Intronic
1063724627 10:8623313-8623335 TGAGACCTACCAAATAATAAAGG + Intergenic
1063778227 10:9289010-9289032 TAATACTTACAAAATATTGATGG - Intergenic
1064861094 10:19826856-19826878 AAAGACTTGCAAAATACTGATGG + Intronic
1065329281 10:24577077-24577099 TAATATCTCCAAAATGTTGAGGG + Intergenic
1066316593 10:34253571-34253593 TAAGACCTGCGGGATAATGAGGG - Intronic
1066986385 10:42471756-42471778 GAAGAACTCAAAAATGATGAAGG + Intergenic
1067820588 10:49525820-49525842 TACGCCCCCCAAGATAATGATGG + Intronic
1068574183 10:58665354-58665376 AAAGACCACTAAAATAATGCAGG - Intronic
1071031992 10:81195970-81195992 TAAATCCTCCAAATCAATGATGG + Intergenic
1071982788 10:91020610-91020632 TGAGATCTCCAAAAGAATGAGGG + Intergenic
1072877155 10:99184943-99184965 TGGTACCTCCAAAAAAATGAAGG + Intronic
1074178950 10:111040164-111040186 TAAAACATTCAAAATACTGAGGG + Intergenic
1078133072 11:8629456-8629478 TGAGACCACCCAAATAATAATGG + Intronic
1079446467 11:20561262-20561284 TAATGCCTTCAAAATAATGAGGG + Intergenic
1082198805 11:49337668-49337690 TTAGACCACCAAAATAAGCAAGG - Intergenic
1085996079 11:81915663-81915685 TACAAACACCAAAATAATGATGG - Intergenic
1086657006 11:89370431-89370453 TTAGACCACCAAAATAAGCAAGG + Intronic
1087319526 11:96640935-96640957 TAAGACATCCACGATTATGAAGG - Intergenic
1088583589 11:111337815-111337837 TAATACATACAACATAATGAAGG + Intergenic
1090648845 11:128789036-128789058 TATGACCTCTAAAATCATAAAGG - Intronic
1093451415 12:19320004-19320026 TAAGAACTAAAAGATAATGAAGG - Exonic
1094210870 12:27889365-27889387 TAATACCTCCAAAAGTCTGAAGG - Intergenic
1095107371 12:38250971-38250993 TAAAACATTCAAAATAAGGAAGG + Intergenic
1097847065 12:64377742-64377764 TAAGAGCTCAAAAATACTTATGG - Intronic
1098387622 12:69935521-69935543 TGAGACTTCAAAAATAACGAGGG - Intronic
1098412154 12:70198022-70198044 TTATATCTCCAAAATAATAATGG + Intergenic
1099138015 12:78932982-78933004 TAAGACGTCCAAAAGTATAAAGG + Intronic
1099169176 12:79343141-79343163 TGAGACCTGCAAAATATTAATGG + Intronic
1099511221 12:83540406-83540428 GAAGACCACCAAAATAATAATGG - Intergenic
1100965967 12:100013214-100013236 TTAGACTCCCACAATAATGATGG + Intergenic
1101069249 12:101056604-101056626 TAGGACCTCCAGAATAATGCTGG + Intronic
1101475264 12:105040293-105040315 TCAGACTCCCAAAATAATGATGG + Intronic
1102107604 12:110338783-110338805 TAAGACCTCAAAAGTCATTATGG - Intronic
1103615962 12:122152460-122152482 TAACACCTCCAAAATACAGACGG + Intergenic
1104486295 12:129153651-129153673 TGAGAACTCCAAAATCAGGAGGG + Intronic
1107084974 13:36417061-36417083 TAAGACCACAACAATAGTGAGGG - Intergenic
1107306942 13:39032332-39032354 TAAGAACTTCAAACAAATGAGGG + Intronic
1108884527 13:55164290-55164312 TATGACCTCCCAAATAATTCAGG - Intergenic
1110306612 13:73995299-73995321 TAAGACCTAGACAAAAATGAGGG + Intronic
1110314460 13:74089342-74089364 AAATATCTTCAAAATAATGATGG + Intronic
1110481459 13:75982408-75982430 TATGGCCTCCATAATTATGAGGG + Intergenic
1111087156 13:83391575-83391597 TAAGAAATCCAAAATAAAGTGGG - Intergenic
1112251771 13:97787893-97787915 GTAGACCTCCAGAATAATGCTGG + Intergenic
1112529801 13:100190045-100190067 TAAGACCTGCCAAGAAATGAAGG - Intronic
1114143503 14:19945613-19945635 TAAAACTTCAAAAATAAAGATGG + Intergenic
1115023412 14:28711566-28711588 AAATTCCTCCAAAAAAATGAAGG + Intergenic
1116154266 14:41184163-41184185 TAATAAATCAAAAATAATGAAGG + Intergenic
1120372618 14:83655960-83655982 TAAGACCTGCAAAAGAAGCAGGG + Intergenic
1120502698 14:85316671-85316693 TAATACCTGTAAAATAATTAGGG - Intergenic
1121380492 14:93461836-93461858 AAAGACCTCCATAATGAGGAAGG + Intronic
1123154159 14:106208364-106208386 GAAGACCTCCAGAATCATGTAGG + Intergenic
1123910757 15:24964602-24964624 TCAGAGCTGCAAAAGAATGAAGG - Intronic
1129039450 15:72673320-72673342 TAAGACCTTAAAAATATTTAAGG - Intergenic
1130828701 15:87577416-87577438 TATGACCTCCAAAGTGCTGATGG + Intergenic
1131632161 15:94189523-94189545 TAAGACCTCAAAAATACTACAGG + Intergenic
1131728781 15:95256593-95256615 CAAGAACCCCAAAATAATAATGG - Intergenic
1133609689 16:7421791-7421813 TCTGACATGCAAAATAATGATGG + Intronic
1134087658 16:11369397-11369419 TAGGGCCTCCAAAATAATAGTGG + Intronic
1138993880 16:62424863-62424885 TGTGACCTCCGAAATAATGGTGG - Intergenic
1139123349 16:64047005-64047027 TAAGACATACAAAATATTGAAGG + Intergenic
1141946387 16:87312986-87313008 TAAGAGCTACAAAATATTTATGG + Intronic
1148776159 17:50096727-50096749 TGAGACCTTCAAAAGGATGATGG + Intronic
1153884690 18:9453977-9453999 AAAGACTTCAAAAATATTGAAGG + Intergenic
1155687308 18:28571140-28571162 TGAGACTTCCAAAAAAATTAAGG + Intergenic
1156171498 18:34492206-34492228 TCACACCACCAAAATAATAAAGG + Intergenic
1156595403 18:38542639-38542661 TAAGTCCTCCAAACTCATGATGG - Intergenic
1161753396 19:6113899-6113921 TACGGCCTCCAATAAAATGATGG - Intronic
1164224123 19:23226953-23226975 AAAGAACTGCAAAATAATAAGGG + Intronic
925769745 2:7270240-7270262 TAAACTCTCCAAAACAATGATGG + Intergenic
926523769 2:13950911-13950933 TAACACCTCCAAAATTAGCAGGG - Intergenic
927626065 2:24720095-24720117 TAAGACCTCATCTATAATGAGGG + Intronic
927847349 2:26478389-26478411 TAAAACCTCCAAAAAAATCAAGG - Intronic
931550847 2:63444509-63444531 TAAGACCTCCAAAATGGAAAGGG + Intronic
932421134 2:71602112-71602134 CAAGACCTCCAGAAGAAGGAAGG - Intronic
933626132 2:84602383-84602405 GAATACCTCCAAATTACTGAAGG - Intronic
933946878 2:87294608-87294630 TAACAACTACAAAATATTGAGGG + Intergenic
935440178 2:103084297-103084319 AAAGACCCCCAAAAAAATGTGGG + Intergenic
935927189 2:108082325-108082347 TAACACCTTAAAAGTAATGATGG - Intergenic
936333312 2:111566947-111566969 TAACAACTACAAAATATTGAGGG - Intergenic
937962702 2:127473365-127473387 TAAGTCCTGTAAAATAATAAGGG - Intronic
938820742 2:134957064-134957086 TTAAGCTTCCAAAATAATGATGG + Exonic
939317021 2:140565467-140565489 TAAAACTTCCCATATAATGAGGG - Intronic
941277585 2:163509363-163509385 TAAGACCTTCATAATGCTGAAGG + Intergenic
941647325 2:168055244-168055266 TAATTCCTCCTGAATAATGATGG + Intronic
941841839 2:170093731-170093753 TAAAACTTCCAAACTAATGTGGG + Intergenic
942386223 2:175446280-175446302 TAAGACTTCAAAAATAATAATGG - Intergenic
942694708 2:178628461-178628483 TAAGAATTCAAAATTAATGATGG + Intronic
943431737 2:187811301-187811323 TAAGCCTTCCAAACTAAAGAAGG + Intergenic
943638777 2:190336033-190336055 CAAGACCTCTAGAATAAGGAAGG - Intronic
944194561 2:197038970-197038992 TGGGACCTCCAAAATAATATGGG - Intronic
945297798 2:208188433-208188455 AAAAAAATCCAAAATAATGAAGG - Intronic
945529794 2:210937780-210937802 AAACACCTGTAAAATAATGAAGG + Intergenic
948138004 2:235651672-235651694 TGAGCCCCCCGAAATAATGATGG + Intronic
1169163255 20:3401084-3401106 TAAACCCTCCAAGAGAATGAGGG + Intronic
1170222471 20:13954646-13954668 TGAGACCTCCAGAGTAAAGATGG - Intronic
1170231370 20:14050358-14050380 CAAGACTGCCAAAATAAGGAAGG - Intronic
1176225392 20:63995320-63995342 TAAGACCTCCAAATTGCTGGAGG - Exonic
1177229530 21:18301890-18301912 TATGACCTCAAAAATAATAATGG - Intronic
1177328333 21:19623058-19623080 TAAAAGCTCCAAAAGGATGAGGG - Intergenic
1178273598 21:31216398-31216420 CATGACCTCCAAAATGCTGAAGG + Intronic
1179305183 21:40147255-40147277 TAAATCCTCCACAAGAATGAAGG + Intronic
1179915402 21:44474442-44474464 GAAGACATTCAAAAAAATGAGGG - Intergenic
1181456421 22:23062601-23062623 TAAGAGCTCTACAAAAATGAGGG - Intronic
1182101450 22:27660448-27660470 TACGACCTGGAAATTAATGAAGG + Intergenic
1182345594 22:29661954-29661976 CAAGAATTCCAAAATAATTAAGG + Intronic
1183766154 22:39877209-39877231 CAAGACCTTCAAATTAGTGAAGG + Intronic
1184815595 22:46866697-46866719 CAAGAACACCAAAACAATGATGG - Intronic
949153004 3:793196-793218 TAAGACCTGCAAAATATTCAGGG + Intergenic
949597441 3:5562850-5562872 CAACACCTCCATAATAATCAGGG - Intergenic
953488948 3:43331047-43331069 TAAAACACCCAAAATAATGTAGG - Intronic
953503436 3:43460066-43460088 AAAGGCATCCATAATAATGAGGG + Intronic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
956691383 3:71880966-71880988 TAAGATCTCAAGAATAAAGAGGG - Intergenic
957204382 3:77176096-77176118 GAAGAGCTCCAAAAGATTGAGGG + Intronic
958576666 3:95958430-95958452 TAAGGCCTTGAAAATAAAGAAGG - Intergenic
959799383 3:110473469-110473491 TAAGAGATCCAACATCATGAAGG - Intergenic
960567932 3:119155300-119155322 TAAAACCTCCAAAAACATGTGGG - Intronic
960812815 3:121641287-121641309 TAAGATCTTCAAAGTGATGAAGG + Intronic
962069009 3:132013579-132013601 TAATTCCTCCAAAGTAAAGATGG + Intronic
962860432 3:139394966-139394988 TATTACCTACAAAATAATAATGG + Intergenic
963288621 3:143463646-143463668 GAAAACCTCCAAAATAATGCTGG + Intronic
964373977 3:156031461-156031483 AAAATCATCCAAAATAATGAAGG + Intergenic
965261902 3:166497741-166497763 TGAAATCTCCAAAATAAAGAAGG + Intergenic
966644342 3:182226592-182226614 TTTGACCCCCAAAATAAAGAGGG - Intergenic
966697525 3:182806757-182806779 TAAGATCTCCAAAGGAATAATGG - Intronic
967450199 3:189614628-189614650 CAAGAGATACAAAATAATGAAGG - Intergenic
968179026 3:196576632-196576654 TTACACTTCCAAAATAAAGAGGG - Intronic
969372323 4:6741157-6741179 TCACACCTACAAAATTATGAAGG + Intergenic
970452421 4:16183558-16183580 TAAAAGCTTCAAAATTATGAGGG - Intronic
970868569 4:20786282-20786304 TAGGAACTCCAAAAGAAGGAGGG + Intronic
971046882 4:22814793-22814815 TAAGACCTCATAAATCATGGTGG + Intergenic
971461820 4:26907480-26907502 TAAGACATCCAAAAGCAAGAGGG - Intronic
972334867 4:38098665-38098687 TAACAACTCCAAACAAATGAGGG + Intronic
972936793 4:44146308-44146330 TAAGACCAACAAAATAATTAAGG - Intergenic
973739526 4:53905978-53906000 TGATACTTCCAAAATAACGAAGG - Intronic
974126290 4:57700317-57700339 GAAGACCTCCAATATGATGTTGG + Intergenic
974371158 4:61018549-61018571 TAAGACCTCCAGAAAAATGTTGG + Intergenic
975371265 4:73591309-73591331 AAAGCCATACAAAATAATGATGG + Intronic
977429598 4:96914446-96914468 TAAGCCCTCCAAAATAATGGAGG + Intergenic
978506139 4:109458632-109458654 TCAGACATTAAAAATAATGATGG + Intronic
978977674 4:114898510-114898532 AAAGACCCACAAAATATTGAAGG - Intronic
980299530 4:130970457-130970479 TAAAATCTGGAAAATAATGATGG + Intergenic
980303308 4:131022880-131022902 TAAAACGTTCAAAATTATGAGGG - Intergenic
980317538 4:131221926-131221948 TTAGACCTGAAAAATAATGTCGG - Intergenic
984766127 4:183401891-183401913 TAAGAACTCCAACATAATCTGGG + Intergenic
984980199 4:185273169-185273191 AAAAACCTCCCAAATAATGATGG + Intronic
985140507 4:186834791-186834813 TAAGACATGCAAAAGAAAGACGG + Intergenic
985866579 5:2519025-2519047 TGAGACCCCCAAAGTAAAGATGG - Intergenic
986441234 5:7783642-7783664 TAAGACCTGAAAAATAAAAATGG - Intronic
986501555 5:8406151-8406173 TAAGCCATCCAAAATCATGGTGG + Intergenic
987052131 5:14156177-14156199 AAAGTGCTCCAAAAAAATGATGG - Intronic
987269668 5:16293611-16293633 TAAAAACCCCAAAACAATGAAGG - Intergenic
987729505 5:21750456-21750478 TATGAGCTCCAATATAATAATGG + Intergenic
987996166 5:25282805-25282827 TAAGACATAAAATATAATGATGG - Intergenic
990167713 5:53013198-53013220 TAAAACCTGGAAAATAATCAAGG - Intronic
993009926 5:82469284-82469306 TAAGAGCACCAAAAGAATCAAGG - Intergenic
995752413 5:115467124-115467146 TACAACTTCCAAATTAATGAAGG + Intergenic
998009805 5:138685499-138685521 TAACACCACCAAAATATTCATGG - Intronic
998371733 5:141666339-141666361 TAAGAACCCCCAAATAATAAAGG + Intronic
998511882 5:142720551-142720573 TAAGGCCCCACAAATAATGAGGG - Intergenic
999752067 5:154635348-154635370 TAAGACCTCCAATATAATGTTGG + Intergenic
1000777138 5:165433557-165433579 TTAGACCTTCAAAATGCTGAAGG - Intergenic
1000894183 5:166835270-166835292 GCAGTGCTCCAAAATAATGATGG + Intergenic
1001148355 5:169204388-169204410 TGAGACGTCCAAAATAAAGGAGG + Intronic
1001930817 5:175671819-175671841 TATGACCTCCAAAAGAAAGAGGG + Intronic
1002879867 6:1241939-1241961 AAATATCTACAAAATAATGAGGG + Intergenic
1004734736 6:18394149-18394171 TAAAAATTCCAAAATAATTAGGG + Intronic
1008113880 6:47524424-47524446 TAAGAACTGCAAGAAAATGAGGG - Intronic
1008704020 6:54136582-54136604 TTAAACCTCCACAAAAATGAAGG - Intronic
1008909464 6:56717538-56717560 TACGACCTCTGGAATAATGATGG - Intronic
1009777879 6:68229353-68229375 TAAGATATCCAACATAATGATGG - Intergenic
1010011733 6:71055657-71055679 TAACAACTCCAGAATACTGACGG + Intergenic
1011184964 6:84663958-84663980 TAAGACAGCCAAATTCATGAGGG + Intergenic
1011708574 6:90028032-90028054 CAAGACCTGCAAGAGAATGATGG + Intronic
1011764826 6:90609634-90609656 TAAAACCACCATAATATTGAAGG + Intergenic
1011894758 6:92211699-92211721 TAAAACCTCTAAAAAATTGAAGG - Intergenic
1011963218 6:93117650-93117672 TAAGTCATACAAAATAATTATGG + Intergenic
1012219078 6:96626272-96626294 TACGACCTCCAAAATTAGAAAGG + Intergenic
1012362221 6:98396656-98396678 TAAGACTGCCATAATAATAATGG + Intergenic
1015351737 6:132226987-132227009 AAAGGCTACCAAAATAATGAAGG - Intergenic
1016315555 6:142782023-142782045 AATGACATCCTAAATAATGACGG + Intronic
1017360789 6:153567718-153567740 TAAAAACTACAAAATATTGATGG + Intergenic
1019132963 6:169890828-169890850 TAAGAATTCCAAAATGTTGATGG + Intergenic
1020653719 7:10905744-10905766 TATGACCTCCAAAAGAATATTGG + Intergenic
1020786528 7:12580164-12580186 AAAGACCTCTATAATAATAATGG - Intronic
1021059867 7:16098491-16098513 TAAGTTCTCCAAAACAAGGATGG - Intronic
1021237561 7:18161326-18161348 TAACACTTTCAAAATAGTGACGG + Intronic
1021545409 7:21807691-21807713 TGAGAACTCCATCATAATGATGG + Intronic
1021638019 7:22710427-22710449 TAAGCCCTCAAAAATATTTATGG - Intergenic
1023192396 7:37596810-37596832 TAAGACCAACCAAATCATGAGGG + Intergenic
1023718337 7:43067138-43067160 TAAGATCTCCAGTATAATGAGGG - Intergenic
1024475879 7:49809985-49810007 TAAGACCTCCACTACATTGATGG - Intronic
1031064725 7:117092688-117092710 TCAGACCTCCAAAGTAAGGTAGG - Intronic
1031159012 7:118143641-118143663 GAAGATCTCCAAAATGTTGAGGG + Intergenic
1031791934 7:126117923-126117945 GAAGACCTCTGACATAATGAAGG - Intergenic
1032678171 7:134152012-134152034 TAAGACCTCCAAAATAATGATGG - Intronic
1032996641 7:137454404-137454426 TAAGAACTGCAACAAAATGAGGG + Intronic
1033221854 7:139532167-139532189 TAATACCTTCAAAATTCTGAAGG + Intronic
1033984158 7:147202260-147202282 TAAATGCTCCAAAATAGTGATGG + Intronic
1036673315 8:10807675-10807697 TAATACCTTCAAAATGCTGAAGG + Intronic
1037193911 8:16163642-16163664 TGAACTCTCCAAAATAATGATGG - Intronic
1038833986 8:31098071-31098093 TAAAACCAACAAAAGAATGAGGG + Intronic
1039641842 8:39231543-39231565 TAAAAAATCCAATATAATGAAGG + Intronic
1039758534 8:40549062-40549084 TAAGGCCTCCATATTCATGAGGG - Intronic
1041289263 8:56293240-56293262 TAGGACCTCCACAAAAATGTGGG - Intergenic
1041894050 8:62903629-62903651 TAAGCCCTCTAGAATAAGGAAGG + Intronic
1042025467 8:64418527-64418549 TAAGTGCTACAAAAAAATGAAGG + Intergenic
1042792026 8:72618284-72618306 CAAGACCTCAAAAATAATTTGGG - Intronic
1043583803 8:81744160-81744182 TGAGACCTCCAAAAATATGGAGG + Intronic
1043865125 8:85365854-85365876 AGGGACCTCCAAAATAATGAAGG + Intronic
1044290681 8:90465402-90465424 AAATACCTGCAAAATGATGAGGG + Intergenic
1046052026 8:109035053-109035075 TAACACTCCCTAAATAATGATGG - Intergenic
1047848377 8:128828273-128828295 CAAGACCCCTAAAATAGTGAGGG + Intergenic
1050262345 9:3853787-3853809 GAAGTTCTCCAAAATATTGACGG - Intronic
1050769075 9:9174017-9174039 TTAAACCTCCATGATAATGAGGG + Intronic
1050820744 9:9876790-9876812 CAAGAAATTCAAAATAATGACGG + Intronic
1055216860 9:73874264-73874286 TAGGAGCTCCAACATAGTGACGG - Intergenic
1056506830 9:87265585-87265607 TAATATTTCCAAAATAATGAAGG + Intergenic
1058340255 9:103886893-103886915 CAAGACCTCCAAAATAAGGATGG + Intergenic
1058382100 9:104388751-104388773 AAAGATCTCCAAAGTGATGAAGG - Intergenic
1061910854 9:133722483-133722505 TAAAACCTCCAATGTAATGTTGG - Intronic
1185578404 X:1191847-1191869 TAAGCCCTCCAACAGACTGACGG + Intronic
1185687789 X:1944068-1944090 TATGATCTCAAAAAGAATGATGG + Intergenic
1186448794 X:9654951-9654973 TAAGACCTACAAAATGATATTGG + Intronic
1188598465 X:31930464-31930486 CAAGACCTCCAAAATCACCATGG + Intronic
1189397450 X:40635655-40635677 TAGGACCTGCAGACTAATGATGG - Intronic
1190512090 X:51183452-51183474 TAAGATCTCCAATAGAATCAAGG + Intergenic
1191226163 X:58045280-58045302 CAAAACCTCAAAAATAAAGAAGG - Intergenic
1192486121 X:71528263-71528285 AAAAACCTGCAAAATAATAATGG - Intronic
1197267930 X:124396183-124396205 TAAGAGCTAAAAAAGAATGAAGG + Intronic
1199323771 X:146472536-146472558 AAAGACTGCCAAAATAAAGAGGG + Intergenic
1200828683 Y:7668764-7668786 TAGGACCTCCAAAATAAAAGAGG - Intergenic
1201014283 Y:9583115-9583137 AAAGACTTTCAAAATAGTGATGG - Intergenic
1201653234 Y:16314674-16314696 CAGGACCTCCAGAATAACGACGG + Intergenic
1201910590 Y:19129745-19129767 TTAGGCCTCCAAATTAATCATGG + Intergenic
1202017540 Y:20426729-20426751 TAATACCTCCAAAATAACAGTGG + Intergenic
1202198655 Y:22324341-22324363 TAGGACCTCCAAGATAAAGAGGG + Intronic