ID: 1032679700

View in Genome Browser
Species Human (GRCh38)
Location 7:134168913-134168935
Sequence TTCCAAGAGAAGTGGCTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 202}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032679700_1032679702 1 Left 1032679700 7:134168913-134168935 CCATGGAGCCACTTCTCTTGGAA 0: 1
1: 0
2: 1
3: 15
4: 202
Right 1032679702 7:134168937-134168959 CTAATCCTTACTAAGTATAGTGG No data
1032679700_1032679703 2 Left 1032679700 7:134168913-134168935 CCATGGAGCCACTTCTCTTGGAA 0: 1
1: 0
2: 1
3: 15
4: 202
Right 1032679703 7:134168938-134168960 TAATCCTTACTAAGTATAGTGGG No data
1032679700_1032679704 5 Left 1032679700 7:134168913-134168935 CCATGGAGCCACTTCTCTTGGAA 0: 1
1: 0
2: 1
3: 15
4: 202
Right 1032679704 7:134168941-134168963 TCCTTACTAAGTATAGTGGGTGG 0: 1
1: 0
2: 0
3: 1
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032679700 Original CRISPR TTCCAAGAGAAGTGGCTCCA TGG (reversed) Intronic
905563412 1:38944764-38944786 TTCAAGGAGTAGTTGCTCCAGGG + Intergenic
905818125 1:40967753-40967775 TTCCCAGAGAACTGTCTCTAAGG - Intergenic
906610566 1:47199036-47199058 GTCCTAGAGGAGTGCCTCCACGG - Intergenic
910045581 1:82910298-82910320 TGCCTAGAGAAGAGGCTCAAGGG - Intergenic
913001323 1:114583214-114583236 TTCCTACAGATGTGGGTCCAGGG - Exonic
914442442 1:147719254-147719276 TTCAAACAATAGTGGCTCCAAGG - Intergenic
914976235 1:152365836-152365858 TTTCAAGACAAGAGTCTCCAAGG - Intergenic
916293051 1:163187591-163187613 ACCCAAGAGAAGTGGGTTCAGGG + Intronic
918384056 1:183987126-183987148 TTCCAAGGGTTGTGACTCCAAGG - Intronic
921195279 1:212750523-212750545 TTCCCAGAGAAGTATCTCCGAGG + Intronic
922051204 1:221992209-221992231 TAGCAAGAGAAATGGCTCCTTGG + Intergenic
924933819 1:248751373-248751395 TTGCAACTGAATTGGCTCCACGG - Intronic
1063113708 10:3057996-3058018 TTCCAAGAGAAGAGGGTACCTGG + Intergenic
1065935816 10:30519708-30519730 ATCCAAGAGAACTGGGTTCAGGG - Intergenic
1066255230 10:33672266-33672288 TCCCAAAAGAATTGGCTCCGGGG - Intergenic
1067794927 10:49313958-49313980 TGAGAAGAGAAGAGGCTCCAGGG + Intronic
1069637882 10:69936744-69936766 TTCCAAATGCAGGGGCTCCAAGG + Exonic
1070589518 10:77791887-77791909 TTCCAGGAGAGGTGCCACCAAGG + Exonic
1072254009 10:93602958-93602980 TTCTAGGAGAAATGGCTGCAAGG - Intronic
1075103194 10:119520011-119520033 TTCCCAGAGTAGGGGCTACAGGG - Intronic
1076486550 10:130823404-130823426 TTAAAAGAAAAGTGGGTCCATGG - Intergenic
1078547333 11:12255844-12255866 TTCCAAGAGAAGAGGAGCCTCGG - Intronic
1079157768 11:17964384-17964406 TACAATGAGAAGTAGCTCCAGGG + Intronic
1080409305 11:32008845-32008867 TTCCAAGAGAAGTAGCACTTTGG - Intronic
1080555855 11:33416675-33416697 TCCAAAGAGAATTGGTTCCAGGG - Intergenic
1081669740 11:44936402-44936424 TTCAAACAGAAGTGGCTCTGGGG + Intronic
1083952390 11:65964165-65964187 TTCTAAGAGAGGTGGCTCTGGGG + Intronic
1084431166 11:69112187-69112209 TTCCCACAGGAGTGGCCCCATGG + Intergenic
1087334441 11:96825702-96825724 TTCAAAGAGAAGTGATTTCAGGG + Intergenic
1088082643 11:105937804-105937826 TTCCAATAGAACTTGCTTCAGGG + Intronic
1091724323 12:2834934-2834956 TTCCAACAGGAGGGTCTCCACGG + Exonic
1094721949 12:33074897-33074919 TTCCTAGAGATGTGGCTTCCTGG + Intergenic
1096981159 12:55728816-55728838 TTCGAAGCAAAGTTGCTCCAGGG + Intronic
1097471063 12:59991989-59992011 TTCCAAGAGCAGTTGCTCTGTGG - Intergenic
1104715660 12:131014473-131014495 GCCCAAGAGAAGGAGCTCCAGGG - Intronic
1105953157 13:25251942-25251964 TTCCAAAAGAAATGGCCACAGGG + Exonic
1110558704 13:76887151-76887173 TTCGAAGTGAAGTGCCTCGAAGG - Intergenic
1110839660 13:80127527-80127549 TTTGAAAAGCAGTGGCTCCAGGG + Intergenic
1111188738 13:84780253-84780275 CTGCAAGAGAAGTGGCTTCAGGG - Intergenic
1111718042 13:91905451-91905473 TACAAAAAGAAGTGGGTCCAAGG + Intronic
1111888511 13:94052918-94052940 GTCCCAGAGTAGTGGCCCCAAGG - Intronic
1112898029 13:104324956-104324978 TTCCATGAGAAGTGAATCCTGGG - Intergenic
1113115140 13:106867278-106867300 TTCAAAGGGCAGCGGCTCCAGGG - Intergenic
1113359575 13:109617428-109617450 TTCCAAGAATAGTGGCTTAATGG + Intergenic
1120486140 14:85115285-85115307 TTCCCACAGAAGTGCATCCAAGG + Intergenic
1125827231 15:42686791-42686813 TTCCAAGAGTGGGGGCTGCAGGG - Exonic
1127819110 15:62639836-62639858 TTCCAGGAAATGTGGCTCCTTGG + Intronic
1129718647 15:77865927-77865949 CTCCTGGAGAAGTGGCTCCTTGG - Intergenic
1130460278 15:84154939-84154961 CTCCTGGAGAAGTGGCTCCTTGG + Intergenic
1130769773 15:86912690-86912712 TGCCAAGAGAAGGAGCTCCCAGG + Intronic
1130857237 15:87851255-87851277 TTCGCAGAGAAGTGGCTTGAGGG - Intergenic
1130942320 15:88521400-88521422 GTCCAAGAAAAGTGTGTCCAAGG - Intronic
1131329746 15:91486067-91486089 CTCCCAGAGAAGTGACTCCCAGG - Intergenic
1131729642 15:95266339-95266361 TTCCAAGACCAGTGGATCCAAGG - Intergenic
1132550370 16:551531-551553 TTCCAGGAGAAACGGCCCCACGG - Exonic
1132828187 16:1915185-1915207 TTGCAAGAGCAGTGGGTGCAGGG - Intronic
1133698456 16:8287241-8287263 TTCCAAGACAAGAGTCTGCAGGG - Intergenic
1134010678 16:10850106-10850128 TTTCAAGAGATTTGGCTTCATGG + Intergenic
1134117102 16:11557263-11557285 TTCCAAGAGTAACCGCTCCATGG - Intronic
1135192224 16:20364017-20364039 TTACAAGCCAAGTGTCTCCATGG + Intronic
1136567896 16:31080903-31080925 CTGCAAGAGGAGTGGCTCCCTGG - Exonic
1136582949 16:31165213-31165235 TTCCAAGAGATGTCCTTCCACGG + Intergenic
1137736144 16:50725300-50725322 TTGCAAGAGAATTCACTCCAAGG - Intronic
1138374038 16:56550362-56550384 TTCTGTGAGAAGTGGCTCCTAGG + Intergenic
1139519061 16:67469569-67469591 TGTAAAGAGAAGTGGCTTCATGG + Intronic
1139649735 16:68356291-68356313 TTCCAGGAGAAGTCACTCCTCGG - Intronic
1140487323 16:75303973-75303995 TTACCACAGAAGTGGCTTCATGG - Intronic
1140626452 16:76800465-76800487 TTCTAAGACATGGGGCTCCAGGG - Intergenic
1140799646 16:78473947-78473969 TTCGAACAGAAGTTCCTCCAAGG - Intronic
1141373033 16:83504767-83504789 TGACAAGAGTAGTGGCTTCAAGG + Intronic
1143896541 17:10141058-10141080 GACCCAGGGAAGTGGCTCCAGGG + Intronic
1146526994 17:33575590-33575612 TTCCAAGAGAATTGGCAGCTGGG + Intronic
1146818590 17:35965415-35965437 TTCAAAGAGAAGAGGCTTCAAGG + Intergenic
1148960355 17:51387326-51387348 CTCCAAGAGAGATGACTCCAAGG - Intergenic
1149338918 17:55666525-55666547 TTCTGAGAGAAGTTTCTCCAGGG + Intergenic
1150197371 17:63314421-63314443 TTCAAAGAGCAGAGGCTTCAAGG - Exonic
1150984789 17:70184004-70184026 TTTCAAGAGAAGTGGCTAGAAGG - Intergenic
1152052973 17:77996834-77996856 TTCTAGGGGCAGTGGCTCCAGGG - Intergenic
1152999204 18:437777-437799 TTCGAAGAAAAGTGGCACCTGGG - Intronic
1153016146 18:584191-584213 TTCTAAGGGCAGGGGCTCCAAGG + Intergenic
1153607681 18:6851105-6851127 TATCAAGACAAGTGGTTCCATGG + Exonic
1155249380 18:23940423-23940445 CTCCAAGAGAAGCTGCTGCAGGG - Intronic
1155532039 18:26777245-26777267 TTCCCAGGGAAAGGGCTCCAAGG - Intergenic
1155900711 18:31386495-31386517 TTCCAAAAGAAGTGGCAGCCAGG + Intronic
1156293843 18:35772870-35772892 TTCCAGGAGAGGTGGGTCCAGGG - Intergenic
1156876431 18:42019277-42019299 TTTCAAGAGATGTGGTTTCAAGG - Intronic
1157128592 18:44981587-44981609 TTGCAAGAGAAGAGCATCCAGGG + Intronic
1158466418 18:57694207-57694229 TTCTAAGAGAACTGCCTCTATGG + Intronic
1158470200 18:57729281-57729303 TGGCAGGAGAATTGGCTCCATGG - Intronic
1158666830 18:59439893-59439915 TACAAAGAGAAATGGCTGCAGGG - Intronic
1160017972 18:75158636-75158658 TTCCAGGAGCAGTGGCACCTGGG + Intergenic
1163947299 19:20550739-20550761 TTCCAAAATAAGTGCCTCTAAGG + Intronic
1164403585 19:27921315-27921337 TACCGAGAGATGTGGCTCCTGGG + Intergenic
1164912594 19:32025081-32025103 CTCAAAGAGAGATGGCTCCAAGG - Intergenic
1168163759 19:54532779-54532801 GCCCAATAGAAGTGGCACCATGG + Exonic
925217658 2:2111025-2111047 GGCCAAGGGAAATGGCTCCAGGG - Intronic
926792515 2:16588751-16588773 TTCTCAGAGGAGTGGCTCCCAGG + Intronic
927144205 2:20150906-20150928 TTCCATCAGAAATGGCTACAAGG - Intergenic
927325208 2:21797465-21797487 TTCCTAGAAAAGTGGGTTCAAGG + Intergenic
928946723 2:36778523-36778545 TTCCAAGAGAAAAGGCTGCCAGG + Intronic
930035603 2:47083495-47083517 TGGCAAGAGAAGGGGCTCCTGGG - Intronic
930055883 2:47251545-47251567 CTCCAAGGAAAGGGGCTCCAAGG + Intergenic
930258743 2:49120732-49120754 TTCCAGGAAAAGAGGCTACAAGG + Intronic
930317576 2:49816478-49816500 TTCCAAGAGCAGTGGCCACTTGG + Intergenic
934107433 2:88708665-88708687 ATCCAAGAGAAGTTGCTCTTGGG + Intronic
937319002 2:120949552-120949574 AGCCAAGAGAAGGGGCTTCAGGG + Intronic
937460468 2:122081113-122081135 TTAAAAGAGAAATTGCTCCAGGG + Intergenic
937879784 2:126856775-126856797 TTCCATGAGAAGTGGCTTCCTGG + Intergenic
938584793 2:132679587-132679609 TGCACAGAGAAGTGTCTCCATGG + Intronic
938602207 2:132853956-132853978 TCACAAATGAAGTGGCTCCAAGG - Intronic
938964244 2:136373913-136373935 TTCCAAATGGAGTGCCTCCAGGG + Intergenic
939187894 2:138882091-138882113 CTTCAGGAGAATTGGCTCCATGG - Intergenic
939320534 2:140614784-140614806 TTCCTAGGGATGTGGCTTCAAGG + Intronic
943510690 2:188823185-188823207 TTCAAAGCAAAGTGGTTCCAAGG + Intergenic
943565856 2:189515450-189515472 TTCCAAGGGAACTGACTACAGGG - Intergenic
946977573 2:225170254-225170276 TTCTAAGAGCAGTGGCTCCAAGG + Intergenic
1168747913 20:259930-259952 TTTCAAGAGAACTTGCTTCAAGG - Exonic
1170984270 20:21243643-21243665 TGACAAGAAAACTGGCTCCACGG - Intronic
1172483910 20:35287364-35287386 TTCCCAGAGAATGGGCTCCCAGG - Exonic
1173226576 20:41165663-41165685 TCCAATGAGAAGTGGTTCCATGG + Exonic
1174029831 20:47614135-47614157 CTCCAAGAGAACTGGTACCACGG - Intronic
1175336614 20:58200267-58200289 TTCCCAGAGCAGTGGTACCATGG - Intergenic
1175370328 20:58483913-58483935 TCCCCAGGGAAGTGGCTCTAGGG + Intronic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178705852 21:34872196-34872218 TTCCTAGATCAGTGGCTCCATGG + Intronic
1178759987 21:35393099-35393121 TTCCAAGACATCTAGCTCCATGG - Intronic
1179081001 21:38170590-38170612 TGACAAGAAAAGTGGCCCCAAGG - Intronic
1181938117 22:26453391-26453413 CTCCAACAGAAATGCCTCCACGG - Exonic
1184093906 22:42306286-42306308 TTCCAAGGAAAGTGGCGCGAGGG + Intronic
952533660 3:34288286-34288308 AACCAAGAGAAGTGGCACCGAGG + Intergenic
953527516 3:43705723-43705745 TTTAAAGAGAAGTGCTTCCAGGG - Intronic
953566415 3:44035643-44035665 TTACAAGAGAAGTTTCTCCATGG - Intergenic
953658074 3:44870056-44870078 TTCCAGTGGAATTGGCTCCAGGG + Intronic
956168026 3:66411038-66411060 ATCCAAGAGCACTGACTCCATGG + Intronic
956213977 3:66828971-66828993 TTCCAAGAACACTGGCCCCAAGG - Intergenic
956409578 3:68965688-68965710 TTCTAAGGGAAATGGCCCCATGG - Intergenic
959495858 3:107050825-107050847 ATCCAAGAGAAGTATCACCAAGG + Intergenic
960506338 3:118499499-118499521 TTCCATGCCAAATGGCTCCAAGG - Intergenic
960532954 3:118785900-118785922 TTCCTATAGAAGAGTCTCCAGGG - Intergenic
963669774 3:148236726-148236748 TTCCAAGAGAAGGGGATGCCTGG + Intergenic
966048691 3:175587047-175587069 TCCCAAGAGTAGTGGGTCCACGG + Intronic
968052208 3:195662885-195662907 TCCCCAGGGAAGAGGCTCCAGGG - Intergenic
968103602 3:195985453-195985475 TCCCCAGGGAAGAGGCTCCAGGG + Intergenic
968301904 3:197623046-197623068 TCCCCAGGGAAGAGGCTCCAGGG + Intergenic
968490959 4:890265-890287 AGCCAAGGGAAGAGGCTCCAGGG - Intronic
969662100 4:8536407-8536429 AGCCAAGAGAAATGGCACCAGGG + Intergenic
974060043 4:57024602-57024624 TTCAAATAGAAGTCGATCCATGG - Intronic
974896982 4:67951822-67951844 TTCTAGGTGAAATGGCTCCATGG - Intronic
979734299 4:124063548-124063570 TTCCCAGAGAAATGCCTCCCAGG - Intergenic
981003922 4:139855388-139855410 GTCCAAGTGAAATGGCTTCAGGG + Intronic
981435448 4:144715788-144715810 TTCCAAGAGACATGGATACATGG - Intronic
983171798 4:164544446-164544468 TAACATGAGAAGTGGCTCCTAGG + Intergenic
985498420 5:224673-224695 TCCCCAGGGAAGAGGCTCCAGGG - Intronic
985721878 5:1493747-1493769 CTCCCAGAGCAGTGGGTCCATGG + Intronic
985811965 5:2096868-2096890 GCCCAAGAGAGGTGGCTCCCTGG - Intergenic
990623170 5:57582186-57582208 TTGCAAGACAAGTGCCTCCAAGG + Intergenic
990749626 5:59000352-59000374 ATCCAAAACAAGTGGCTCCCTGG + Intronic
991927158 5:71717102-71717124 TTCCAATAGAAGTAGCACAAAGG + Intergenic
993074956 5:83217775-83217797 TCCCAAGGGAAGTGGCTTAAGGG + Intronic
996409817 5:123145489-123145511 ATCCAAGAGATGAGGCACCAAGG - Intronic
996884252 5:128337558-128337580 TTCCATGAGAAGTGGGTTAAGGG + Intronic
999280455 5:150361921-150361943 ATCCAAGAGCAGTGGGGCCATGG + Intronic
999773547 5:154793362-154793384 TCCCAAGATCAGTGTCTCCATGG - Intronic
1000449593 5:161369099-161369121 TTCAAAGATAAGAAGCTCCAGGG - Intronic
1001045525 5:168368626-168368648 TTCCATGGGGAGTGACTCCATGG - Intronic
1001292966 5:170477943-170477965 CTCCAATAGAAGTGCCTCCAGGG + Intronic
1006025191 6:31142372-31142394 CTCCAAGAGAGATGGCTGCAGGG + Intergenic
1007167823 6:39841155-39841177 TTCCAGGGGGAGAGGCTCCAGGG + Intronic
1007167898 6:39841335-39841357 TTCCAGGGGGAGAGGCTCCAGGG + Intronic
1008354147 6:50531763-50531785 GACTAAGAGAAATGGCTCCAGGG - Intergenic
1008484480 6:52020563-52020585 TTCCCAGAGCAGTAGCTGCAAGG - Intronic
1009336780 6:62500822-62500844 TTCCAAGAGAAGTATCATCATGG - Intergenic
1009865630 6:69394267-69394289 TTTCAATAGAGATGGCTCCAAGG + Intergenic
1012589345 6:100960657-100960679 TTTCAAAAGAATTGGCTTCAAGG - Intergenic
1013605480 6:111743540-111743562 TTCCAAAAGAAGAGGCACCGAGG - Intronic
1014102182 6:117523585-117523607 TTCTAAGGGAATTGGCTCTAGGG + Intronic
1015656461 6:135524624-135524646 TTCCAAGAAAACAGGCTCTAAGG + Intergenic
1015818959 6:137239799-137239821 TTCCAAAAGAAGAGGCTTGAAGG - Intergenic
1017129793 6:151098422-151098444 TTCCGAGAAAAGGGGCGCCAAGG + Intronic
1017643027 6:156512856-156512878 TTCCAGGAGAAGGGGAGCCAAGG - Intergenic
1018371556 6:163173369-163173391 TTCCAAAAACAGTGGCTCCTTGG + Intronic
1019557594 7:1640502-1640524 TTCCAACGCCAGTGGCTCCAAGG - Intergenic
1020011045 7:4805894-4805916 TTCCAAGGGCAGCTGCTCCAGGG + Intronic
1022554491 7:31278992-31279014 TTTTAATAGAAGTGTCTCCATGG - Intergenic
1022720441 7:32937695-32937717 CTCCAAGAGAGGTTGGTCCAGGG - Intergenic
1023526925 7:41114255-41114277 TTTCAAGAGGAGTGAATCCAAGG - Intergenic
1023896996 7:44442380-44442402 TGCCAAAAGAAGTAGTTCCAGGG + Intronic
1024102956 7:46051358-46051380 TTCCTAGAGATGCGGTTCCATGG - Intergenic
1026510251 7:71021469-71021491 TTGGAAGAGAAGGGGCTCCTGGG - Intergenic
1028934678 7:96451836-96451858 TGCCAAGAGAACAGGCTCCCAGG - Intergenic
1029945667 7:104530059-104530081 TTCCAACAGAAGTTGTACCAAGG - Intronic
1032679700 7:134168913-134168935 TTCCAAGAGAAGTGGCTCCATGG - Intronic
1033417794 7:141179626-141179648 TTACAAGAGAAAGGGCTGCAGGG + Intronic
1034938517 7:155215055-155215077 TTCCAAGAAAAGTGGATCGGGGG + Intergenic
1035165081 7:156984725-156984747 TACCAATAGAAGTGGCTGCGTGG + Intergenic
1041959988 8:63602220-63602242 GTCCAAGAAAGGTGGCTCCCTGG + Intergenic
1042227362 8:66524656-66524678 TTCAAAGAAAAGTTGCTCCTAGG + Intergenic
1048336679 8:133507761-133507783 TTCCAGGTGAAGTGGCTCCGAGG - Intronic
1048791618 8:138109418-138109440 TTCCAAGAAAAGAGAGTCCAAGG - Intergenic
1050222590 9:3411110-3411132 TTGTGAGAAAAGTGGCTCCATGG - Intronic
1053510565 9:38684292-38684314 CTCCAGGAAAGGTGGCTCCATGG + Intergenic
1059542618 9:115144942-115144964 TTTCCCGAGAACTGGCTCCAAGG + Intronic
1060231686 9:121830199-121830221 TTCTAAGAGAAGGGTTTCCATGG - Intronic
1060525916 9:124321327-124321349 TTGCTAGAGAAGTGGGTCCCAGG - Intronic
1060983519 9:127807154-127807176 TCCCCAGAGAAGGGGCTGCATGG + Intronic
1061751191 9:132778147-132778169 TTCCAAGAGAAAAGGCACCATGG + Intronic
1185874064 X:3687884-3687906 CTCCAAGAGAGGTGGCTACATGG + Intronic
1186100519 X:6151496-6151518 GTCCCAGTGATGTGGCTCCAAGG + Exonic
1187390813 X:18885667-18885689 GGCCAAGAGGATTGGCTCCAAGG - Intergenic
1188245509 X:27832019-27832041 TTCCTAGAGCAGTGACTTCAAGG + Intergenic
1188377444 X:29449189-29449211 TCCCAAGATTAGTGGCTGCAGGG + Intronic
1189987823 X:46569833-46569855 GTCAAAGAGAAGTGGCCACATGG - Intergenic
1196078022 X:111598987-111599009 TTCCAAGACAGCTGCCTCCATGG + Intergenic
1196461383 X:115935478-115935500 TTCCAACTGTAGTGGCTACAGGG - Intergenic
1196962390 X:121017394-121017416 TTTTAAAAGAAGTGGCTCCTTGG + Intergenic
1199565534 X:149211874-149211896 CTGCAAGAGAAGTGGCCCCAAGG + Intergenic
1201499061 Y:14622068-14622090 GTCTAAGTGAGGTGGCTCCAAGG - Exonic
1202378974 Y:24260234-24260256 CTCCTGGAGAAGTGGCTCCTTGG - Intergenic
1202491808 Y:25409887-25409909 CTCCTGGAGAAGTGGCTCCTTGG + Intergenic