ID: 1032680983

View in Genome Browser
Species Human (GRCh38)
Location 7:134183041-134183063
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032680983_1032680986 15 Left 1032680983 7:134183041-134183063 CCATCGCGCCCGGCTGCGGGAGA No data
Right 1032680986 7:134183079-134183101 CATTCTTTAGTCCAGTCTTCAGG 0: 1
1: 0
2: 0
3: 8
4: 144
1032680983_1032680987 20 Left 1032680983 7:134183041-134183063 CCATCGCGCCCGGCTGCGGGAGA No data
Right 1032680987 7:134183084-134183106 TTTAGTCCAGTCTTCAGGCTTGG 0: 1
1: 0
2: 1
3: 11
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032680983 Original CRISPR TCTCCCGCAGCCGGGCGCGA TGG (reversed) Intronic