ID: 1032681330

View in Genome Browser
Species Human (GRCh38)
Location 7:134186932-134186954
Sequence TGAATGAGTTTGTAGTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 333}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032681330 Original CRISPR TGAATGAGTTTGTAGTTGGG AGG (reversed) Intronic
900747724 1:4372706-4372728 TGGATGAGTAGGTAGATGGGTGG - Intergenic
900976736 1:6021724-6021746 GGTATGAGTGTGTAGTTCGGTGG + Intronic
901262506 1:7884693-7884715 TGAGTGAGTGTGTGGTTGGATGG - Intergenic
901863579 1:12089845-12089867 TGGATGAGTGGGTAGATGGGTGG - Intronic
901863711 1:12090362-12090384 TGGATGAGTGAGTAGATGGGTGG - Intronic
901863773 1:12090608-12090630 TGAATGAGTGGGTGGATGGGTGG - Intronic
902322359 1:15677108-15677130 TGTATGAGTGTGAAGTTGGGTGG - Intergenic
902731468 1:18372683-18372705 TGGATGAGTGTTTAGATGGGTGG + Intronic
903181761 1:21608451-21608473 TGAATGAGTGGGGAGTGGGGAGG + Intronic
904368751 1:30035168-30035190 TGAGTGAGTGTGTGGTTGGGTGG - Intergenic
905181270 1:36168507-36168529 TAAAGGAGTTTGCAGTTGGCTGG + Intronic
905241270 1:36583149-36583171 TGAATGAGTTGGTGGGTGGGTGG - Intergenic
905514723 1:38553975-38553997 TGAAGGAGTTTGGAGTTGCATGG - Intergenic
905514728 1:38554007-38554029 TGAAGGAGTTTGGAGTTGCGTGG - Intergenic
906464201 1:46061564-46061586 TCAATGAGTTTACAGTTGAGTGG + Intronic
907839049 1:58138925-58138947 TGAATGAGTGAATAGGTGGGTGG + Intronic
908406858 1:63823283-63823305 TGAATGAGTGGGTGGATGGGAGG - Intronic
909258189 1:73451154-73451176 TGATGGAGTGTGCAGTTGGGGGG + Intergenic
909816673 1:80003040-80003062 TGAAGGAGGTTGTATGTGGGAGG + Intergenic
912002655 1:104854556-104854578 TAAATGAGTTGGTAGGTGGAAGG - Intergenic
913006290 1:114635550-114635572 TGAATGAGTTTGTATATGATTGG - Intronic
913406313 1:118496358-118496380 TGAATTCTTTTGTAGTTGGGTGG - Intergenic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
916519586 1:165551839-165551861 TGGATGACTTTGTACTTGGTAGG - Intronic
917680208 1:177358184-177358206 AGAATGAATGTTTAGTTGGGTGG + Intergenic
919483529 1:198118818-198118840 TGAATGAGTCTATAGTTCAGAGG - Intergenic
920182344 1:204140027-204140049 TCAATGAGTTTGCAGGTGAGAGG - Exonic
920440105 1:205975207-205975229 TGAATGAGGGTGTGGGTGGGTGG - Intergenic
920801891 1:209196122-209196144 TGAATCAGTTTCTGGGTGGGAGG - Intergenic
921329743 1:214023673-214023695 TGTGAGAGTTTGTGGTTGGGAGG + Intronic
921958862 1:221013079-221013101 TGGATGACATTGAAGTTGGGTGG - Intergenic
922559470 1:226558666-226558688 TGAATGTGTGTGTGGGTGGGTGG + Intronic
922743781 1:228031629-228031651 TGAATGTGTATGTGGTTTGGTGG + Intronic
923002220 1:230016741-230016763 TAAATGAGTTGGTAGTTTGTGGG + Intergenic
923354644 1:233142370-233142392 TAAATGAATTTGTAGTTGGAGGG - Intronic
923393416 1:233536286-233536308 TGAATGTGTTTGAGGTGGGGTGG + Intergenic
1062943674 10:1444162-1444184 TGAATGAGTAAGTGGGTGGGTGG - Intronic
1063825374 10:9891396-9891418 TGACTGAGGTTGGGGTTGGGTGG - Intergenic
1064234913 10:13564965-13564987 TGTATGAGTGTGAAGTTTGGTGG + Intergenic
1064429932 10:15262127-15262149 TCAATGAGTTTGGATTTGTGTGG + Intronic
1066121087 10:32288434-32288456 TGAATTAGTAGGTACTTGGGAGG - Intronic
1067709584 10:48637400-48637422 TGAATGAGTGGGTGGATGGGTGG + Intronic
1070021734 10:72593080-72593102 TGAAAGAGTATGGAATTGGGTGG - Intronic
1071509070 10:86250018-86250040 TGAATGGGTGGGTAGTTGGATGG + Intronic
1072246448 10:93547861-93547883 TGAATGGGTTTGTGGGTGGATGG + Intergenic
1072629370 10:97134870-97134892 TGAGTGGGTTAGTAGCTGGGAGG - Intronic
1072946973 10:99819132-99819154 TGGATGAGATTGTAGTTCTGGGG + Exonic
1074545006 10:114395514-114395536 TGAATGAGCTTATTGTTTGGAGG - Intronic
1074957818 10:118409865-118409887 TGAATGAGGGTGTAGTAGGGTGG + Intergenic
1075170772 10:120111598-120111620 TGAGTGGGTGTGCAGTTGGGAGG + Intergenic
1076325974 10:129623386-129623408 TGATGGAGTTTGGAGTTGGGGGG + Intronic
1076499489 10:130925162-130925184 TGAATGAGTTAGCAGGTTGGAGG + Intergenic
1076578095 10:131484194-131484216 TGAATGAGTTGATGGATGGGTGG + Intergenic
1076845015 10:133065690-133065712 TGGATGAGTTGGTGGATGGGTGG + Intergenic
1076845152 10:133066143-133066165 TGAATGAGTGGGTGGATGGGTGG + Intergenic
1076845181 10:133066228-133066250 TGAATGAGTGGGTGGATGGGTGG + Intergenic
1076845222 10:133066357-133066379 TGAATGAGTGGGTGGATGGGTGG + Intergenic
1076845263 10:133066489-133066511 TGAATGAGTGGGTGGATGGGTGG + Intergenic
1076845307 10:133066629-133066651 TGAATGAGTGGGTGGATGGGTGG + Intergenic
1077294896 11:1821718-1821740 TGAATGAGTGGGTAGATGAGTGG + Intergenic
1077311995 11:1892976-1892998 TGAATGAGTAAGTGGGTGGGTGG + Intergenic
1077312034 11:1893155-1893177 TGAATGAGTAAGTGGGTGGGTGG + Intergenic
1078411356 11:11122469-11122491 TGAATGGGTTTGGAGTGGTGGGG - Intergenic
1080651133 11:34223499-34223521 TGAGTGTGTGTGTGGTTGGGAGG - Intronic
1081353796 11:42088622-42088644 GCAATGAGTTTGTGGTTGGTGGG + Intergenic
1081649548 11:44814686-44814708 TGAATGAGTGGGTGGGTGGGTGG - Intronic
1081789976 11:45775591-45775613 TGACTGAGTCTCTAGGTGGGAGG - Intergenic
1082131561 11:48496364-48496386 TGACTGAGTTTGTCCTTGTGGGG + Intergenic
1082565063 11:54667318-54667340 TGACTGAGTTTGTCCTTGTGGGG + Intergenic
1083044645 11:59723082-59723104 TGAATAAGTTTGGAGTTCAGGGG - Intronic
1083828450 11:65216438-65216460 TGAATGAGTGGGTGGGTGGGTGG + Intergenic
1083828470 11:65216558-65216580 TGAATGAGTGAGTAGGTGGGTGG + Intergenic
1084457289 11:69275346-69275368 TGGATGAGTGTATAGGTGGGTGG - Intergenic
1087032687 11:93721738-93721760 TGAATGAGATTGAGGGTGGGGGG + Intronic
1087283488 11:96239224-96239246 TGAATGATTTAATACTTGGGAGG + Intronic
1090107929 11:123871396-123871418 TGATGGACTTTGTAGTTGGAAGG + Intergenic
1092308247 12:7323781-7323803 GGAATGAGGGTGCAGTTGGGGGG + Intronic
1095152284 12:38809631-38809653 TGAATGTGTTTTTATATGGGAGG - Intronic
1095710416 12:45282153-45282175 TGAGTGTGTTTGTGGTTGAGAGG + Intronic
1096707194 12:53429734-53429756 TTGCTGAGTCTGTAGTTGGGGGG + Intronic
1098724888 12:73951378-73951400 TACATGAGTTTGTAGTTTAGGGG + Intergenic
1098789522 12:74804011-74804033 TCACTGAGTTTTTAGATGGGTGG + Intergenic
1101692868 12:107097506-107097528 TGAATGAGTTAGGACTTTGGGGG + Intergenic
1101932912 12:109029566-109029588 TGTATGAGTGTGAAGTTTGGTGG + Intronic
1102987415 12:117289908-117289930 TGTATGAGTTTGAAGTTTGGTGG + Intronic
1104906697 12:132217357-132217379 TGAATGAGTAGGTAGATGGATGG - Intronic
1104906763 12:132217669-132217691 TGAATGAGTAGGTAGATGGATGG - Intronic
1106428942 13:29660848-29660870 TGAATGAGTGTGGAGCAGGGTGG + Intergenic
1107677412 13:42811344-42811366 TGAAGGAGTTTGTTGTTGTTTGG + Intergenic
1112916289 13:104554587-104554609 TGAATGAGTTGATGGCTGGGTGG - Intergenic
1113581776 13:111435082-111435104 TGAGTGAGTGGGTAGGTGGGTGG + Intergenic
1113746048 13:112745436-112745458 TGAATGATTATTTATTTGGGTGG - Intronic
1113780240 13:112972631-112972653 TGAATGAGTTGGTAGATAGATGG + Intronic
1115287292 14:31729283-31729305 TGAATGACTTTTTTTTTGGGGGG - Intronic
1115430734 14:33315531-33315553 TGTATGTGTGTGTGGTTGGGAGG + Intronic
1116425313 14:44783438-44783460 TTAATGTGTTTGGAGTTGAGTGG - Intergenic
1116954416 14:50909572-50909594 TGAACCAGTTTCTAGTTGGAAGG - Intronic
1118009674 14:61596936-61596958 GGAATGAGATTGGAGGTGGGTGG + Intronic
1120101378 14:80449356-80449378 TGCTTCAGTTTGTAGTTGGCTGG + Intergenic
1120213202 14:81654793-81654815 TGTATGAGTATGTAATAGGGAGG + Intergenic
1120646702 14:87082830-87082852 TGAATTTGTTTGGTGTTGGGAGG - Intergenic
1121799323 14:96760590-96760612 TGAATGAGTGGGTAGATGGATGG + Intergenic
1122340190 14:101022983-101023005 TGAAGGAGTGGGTAGATGGGAGG - Intergenic
1122879790 14:104685617-104685639 TGAATGGGTGGGTAGGTGGGGGG + Intergenic
1122879832 14:104685778-104685800 TGAATGGGTGAGTAGGTGGGTGG + Intergenic
1122879973 14:104686294-104686316 TGAATGGGTGGGTAGGTGGGTGG + Intergenic
1122923816 14:104890846-104890868 TGAATGAGTGGGTGGGTGGGTGG + Intronic
1123126303 14:105948646-105948668 TGAATGGGTGGGTAGGTGGGTGG - Intergenic
1123406818 15:20024711-20024733 TGAATGAGTGGGTAGGTGGGTGG - Intergenic
1123516147 15:21031359-21031381 TGAATGAGTGGGTAGGTGGGTGG - Intergenic
1125965075 15:43867802-43867824 TCAATGTGTTTGTTGTTGGGAGG + Exonic
1126309317 15:47297958-47297980 TGGATGAGTTTGGAGATGTGAGG + Intronic
1126389285 15:48128680-48128702 AGAATGAGTGTGTAGCAGGGAGG - Intronic
1126471666 15:49018616-49018638 TGAATGAGTTAATAGATGGGAGG - Intronic
1127711526 15:61603790-61603812 TGAATGAGCTTCCAGTTGAGTGG - Intergenic
1128729885 15:70014039-70014061 TGAATGGGAGTGTAGTTGAGAGG - Intergenic
1128824235 15:70696314-70696336 TCATTGAGTTTATAGTTGAGTGG - Intronic
1129014591 15:72455248-72455270 TGACTGAGTTTGGAGCTGGAAGG - Intergenic
1129339840 15:74878434-74878456 TGAGGGAGTCTGTAGTTGTGAGG - Intergenic
1129936207 15:79452069-79452091 TGAATGTGTTTGTGGATGTGTGG + Intronic
1133111604 16:3551236-3551258 TGAATGAGTGAGTGGGTGGGTGG - Intronic
1133229562 16:4360119-4360141 TGGATGAGTGGGTAGATGGGTGG - Intronic
1133339768 16:5028632-5028654 TGAAGGAGGTGGTAGCTGGGTGG - Intronic
1133462734 16:6000950-6000972 TGAATGAGTGGGTAGATGAGTGG + Intergenic
1134517885 16:14901607-14901629 TGAAAGAATATGTAGATGGGTGG - Intronic
1134663668 16:16003262-16003284 TGGATGAATTGGTAGGTGGGTGG + Intronic
1134663699 16:16003391-16003413 TGGATGAATTGGTAGGTGGGTGG + Intronic
1134663731 16:16003520-16003542 TGGATGAATTGGTAGGTGGGTGG + Intronic
1134663824 16:16003875-16003897 TGAATGAATTGGTGGGTGGGTGG + Intronic
1134705554 16:16300258-16300280 TGAAAGAATATGTAGATGGGTGG - Intergenic
1134961987 16:18411856-18411878 TGAAAGAATATGTAGATGGGTGG + Intergenic
1134966285 16:18494455-18494477 TGAAAGAATATGTAGATGGGTGG + Intronic
1137576809 16:49605310-49605332 TGAATGAGATGGAACTTGGGCGG + Intronic
1137579722 16:49626609-49626631 TGATTGTGTATGTAGATGGGTGG - Intronic
1137821977 16:51454870-51454892 TGAAGGAGTTTGTTGTCTGGTGG - Intergenic
1138249004 16:55488300-55488322 TCAATCATTTTGTTGTTGGGTGG + Intronic
1138547793 16:57729799-57729821 TGGATGAGTGAGTAGGTGGGTGG + Intronic
1138547816 16:57729895-57729917 TGAGTGAGTGAGTAGGTGGGTGG + Intronic
1138547904 16:57730250-57730272 TGAGTGAGTGAGTAGGTGGGTGG + Intronic
1140067664 16:71625308-71625330 TGGGTGAGTTGGTAGATGGGTGG + Intergenic
1140300207 16:73750012-73750034 TGAATGGATGGGTAGTTGGGTGG - Intergenic
1140650120 16:77079088-77079110 TGAATGAATTAGTAGATGGATGG + Intergenic
1141297240 16:82781568-82781590 TGAATAAGTGGGTAGGTGGGTGG - Intronic
1141488185 16:84354958-84354980 AAAATAAGTTTGTGGTTGGGTGG + Intergenic
1141943495 16:87294211-87294233 TGGATGAGTGGGTAGATGGGTGG + Intronic
1142083544 16:88163974-88163996 TGAATGATTGGGTAGATGGGTGG + Intergenic
1142255284 16:89011027-89011049 TGAATAAGTGTGTGGATGGGTGG - Intergenic
1142255420 16:89011569-89011591 TGGATGAGTGTGTGGGTGGGTGG - Intergenic
1142255474 16:89011785-89011807 TGGATGAGTGTGTGGGTGGGTGG - Intergenic
1142526858 17:548853-548875 TGAATGAGTTTGTGATTAGTAGG - Intronic
1142768871 17:2082347-2082369 TGAATTAGATTTAAGTTGGGTGG - Intronic
1143269705 17:5666465-5666487 TGAAGGAGTTTATAGTCTGGTGG - Intergenic
1145408504 17:22633089-22633111 TGAATGAGATTGTGGTGGAGAGG + Intergenic
1146483595 17:33225496-33225518 TTAATGATTTTGTATTTGTGGGG - Intronic
1148346017 17:46904157-46904179 TGAATTAGTGGGTAGATGGGTGG + Intergenic
1148899358 17:50865247-50865269 GGAAAGTGTTTGTAGTTTGGGGG - Intronic
1148908683 17:50928062-50928084 TGAATGAGTGAGTGGATGGGTGG - Intergenic
1149453752 17:56770649-56770671 TGAATGGGTGGGTAGGTGGGTGG - Intergenic
1149600668 17:57891149-57891171 TGTATGAGTGTGGAGTTGAGGGG - Intronic
1150125025 17:62629753-62629775 TGAATTACGTTGTTGTTGGGAGG + Intronic
1150510914 17:65752296-65752318 TGTATGGGTTTGTGGATGGGTGG + Intronic
1151922467 17:77167759-77167781 TGAAGCAGTTTTTAGTGGGGAGG + Intronic
1153032156 18:724698-724720 TGAATGAGTTAGTGGCTAGGGGG - Intronic
1161090444 19:2357504-2357526 TGAATGGGTGTGTGGATGGGTGG - Intergenic
1161090471 19:2357620-2357642 TGAATGAATGGGTAGATGGGTGG - Intergenic
1161227483 19:3153773-3153795 TGAATGAATGGGTAGATGGGTGG + Intronic
1161227573 19:3154226-3154248 TGAATGAATGGGTAGATGGGTGG + Intronic
1161227593 19:3154308-3154330 TGAATGAATGGGTAGATGGGTGG + Intronic
1161242731 19:3231538-3231560 TGGATGGATTTGTAGATGGGTGG + Intronic
1161242739 19:3231570-3231592 TGGATGGATTTGTAGATGGGTGG + Intronic
1161287371 19:3475789-3475811 TGAGTGAGTGTGTGGGTGGGCGG + Intronic
1161287439 19:3476237-3476259 TGAATGAGACTGTAGGTGGGTGG + Intronic
1161633158 19:5369549-5369571 TGGATGAGTGAGTGGTTGGGTGG - Intergenic
1161974251 19:7599923-7599945 TGGATGAGTTGGTGGGTGGGTGG - Intronic
1162155583 19:8676192-8676214 TGAATGGGTGGGTAGTTGGATGG + Intergenic
1165193489 19:34082803-34082825 AGAATGTGTTTGTAGCTGGGAGG - Intergenic
1165893082 19:39126301-39126323 TGAATGAGTTTTAGGTTCGGGGG + Intronic
1166282287 19:41802212-41802234 TGAATGAGGGTGGAGTCGGGAGG - Intronic
1166645613 19:44529620-44529642 TGTGTGAGTTTGTAGCAGGGTGG - Intronic
1167774816 19:51547992-51548014 TGTATGAGTGTGAAGTTTGGTGG - Intergenic
1168086929 19:54054922-54054944 TGAATGAGTGGGTAGGAGGGTGG + Intronic
1168725437 19:58578689-58578711 TGTATGCGTTTGTGCTTGGGAGG + Intergenic
925978413 2:9156870-9156892 TGTATGGGTGTGTAGATGGGTGG + Intergenic
927660085 2:24985800-24985822 TGAATGAATTTGTCGTTTTGTGG + Intergenic
927848889 2:26486423-26486445 TGGATGGATTTGTAGATGGGTGG + Intronic
928788777 2:34925011-34925033 TGACATAGTTTGTAATTGGGGGG - Intergenic
931651325 2:64471506-64471528 AGACTGTGTTTGTAGTTGGCTGG + Intergenic
933238406 2:79891176-79891198 CAAATGAATTTATAGTTGGGAGG + Intronic
936470365 2:112793153-112793175 GGAATGAGTTAAAAGTTGGGGGG + Intergenic
936502623 2:113078196-113078218 TGAAGGAGTTTTTATCTGGGAGG + Intergenic
937210564 2:120266859-120266881 TGAATGGGCTTGAAGTTTGGTGG + Intronic
939221275 2:139304486-139304508 TGATTGAGTATGCATTTGGGTGG - Intergenic
940109735 2:150138358-150138380 TGTCTGAGTTTGTTGTTGGCTGG - Intergenic
940674518 2:156712450-156712472 AGAATGTGTTGGTAGTTGGATGG + Intergenic
941379174 2:164770571-164770593 TGAATGTGATGGTAGTTGGGCGG - Intronic
943429411 2:187779261-187779283 TGGAAGACTTTGTAGTTGTGTGG + Intergenic
944135821 2:196398107-196398129 TGGATGGGTTTGTGGGTGGGTGG + Intronic
944186798 2:196957895-196957917 TGAATGAGTTTAAAATTGTGAGG + Intergenic
944290953 2:198004381-198004403 TGAATGAATTTGTCATTTGGGGG + Intronic
945035035 2:205697333-205697355 TGTGTGTGTGTGTAGTTGGGTGG + Intronic
945320322 2:208414082-208414104 TGTATGAGTGTGAAGTTTGGTGG + Intronic
945819402 2:214645478-214645500 TGAATGAGCTTGTTGGTTGGTGG - Intergenic
945996446 2:216440771-216440793 TGGATGACTCTGTTGTTGGGGGG + Intronic
948375354 2:237517260-237517282 TGAATGAGTGGATAGATGGGTGG + Intronic
948375440 2:237517666-237517688 TGAATGAGTGGGTAGATGGGTGG + Intronic
948815664 2:240509166-240509188 TGAGTGAATGGGTAGTTGGGTGG + Intronic
1170605812 20:17874399-17874421 TGTATGAGTGTGTGGGTGGGTGG - Intergenic
1171942062 20:31340326-31340348 TGAATGGATTTGTAGTTTGACGG + Intergenic
1173262583 20:41450148-41450170 TTAATGATTTTGTAGTTGTTGGG - Intronic
1173477692 20:43373485-43373507 TGAATGATTTTGTCTCTGGGTGG - Intergenic
1174217650 20:48929491-48929513 TGAAGGAGTTTGCAGTTGAATGG + Intronic
1174459326 20:50671825-50671847 TGGATGAGTGGGTAGATGGGTGG + Intronic
1175817229 20:61889578-61889600 TGAATGAGTTAGTGGATGGATGG + Intronic
1178786326 21:35657036-35657058 TGAATGTGTGTGTATTTGGAGGG - Intronic
1179054020 21:37915262-37915284 TGAATTATTTTGTAATTGGAAGG - Intronic
1179369171 21:40788484-40788506 TGAATGAGTTTCTACTGAGGAGG - Intronic
1179413909 21:41182683-41182705 TGCATGAGTGTGGAGGTGGGCGG - Intronic
1179504158 21:41828900-41828922 TGAGTGTGTTTGTATTTGTGTGG - Intronic
1181441521 22:22938316-22938338 TGGATGAGTGGATAGTTGGGTGG + Intergenic
1181783242 22:25207783-25207805 TGAATGAATGGGTAGATGGGTGG - Intergenic
1183078120 22:35439403-35439425 TGAATGAATATGTGGGTGGGTGG - Intergenic
1184123713 22:42471720-42471742 TGGATGAGTGTGTGGATGGGTGG - Intergenic
1184954556 22:47877094-47877116 GGAGTGAGTTTGTGGATGGGAGG - Intergenic
1184977583 22:48073753-48073775 TGAATGGGTATATAGATGGGTGG - Intergenic
1185014783 22:48336493-48336515 TGACTGAGTTGTTGGTTGGGTGG + Intergenic
1185092719 22:48785022-48785044 TAAATGAGGTTGTAGGAGGGAGG + Intronic
949653884 3:6193985-6194007 TGTATGAGTGTGAAGTTTGGTGG - Intergenic
950121961 3:10488017-10488039 TGAATGAGTGAGTAGATGGGTGG - Intronic
950532222 3:13558805-13558827 TGAATGGGTAGGTAGGTGGGTGG - Intronic
951405091 3:22286841-22286863 TGTATTATTTTGTTGTTGGGTGG + Intronic
957149094 3:76462009-76462031 TGATTGAGGTTGTTGTTGGTGGG - Intronic
957918185 3:86713571-86713593 TGAAGGAATTTCTAGTTGGGGGG + Intergenic
958633076 3:96705531-96705553 TAAATGAGTTTGTTGTAGGATGG - Intergenic
958685320 3:97386081-97386103 TGAATGAGTTAGAACTTTGGGGG - Intronic
960628844 3:119707794-119707816 TGATTGAGTTTGTTGTTGCTTGG + Intronic
961408166 3:126698168-126698190 TGAATAAATCTGTCGTTGGGTGG + Intergenic
961996663 3:131252549-131252571 TGAATGAGTTAGCATTTGTGTGG + Intronic
963583670 3:147157617-147157639 TGAATGACTTTGAAGTTTGAAGG + Intergenic
964496926 3:157301480-157301502 TGAATGGGTTGGTAAGTGGGGGG - Intronic
965354826 3:167660987-167661009 TGTATGAGTTAGTAGATGTGTGG + Intergenic
965419044 3:168433826-168433848 TGAATGTATTTGCAGTTTGGAGG + Intergenic
965671973 3:171156928-171156950 TGAATGGGTCAGTAGTTGAGAGG - Intronic
966315689 3:178643221-178643243 AGAATGGGTTTGTAGTTGCCAGG + Intronic
966728527 3:183130917-183130939 TGAATGTGTGTGTGGTTAGGAGG + Intronic
968761967 4:2447199-2447221 TGAATGAGTTGGTAGATAGATGG + Intronic
968924862 4:3541826-3541848 TGAATGAATTGATAGGTGGGTGG + Intergenic
969205429 4:5640379-5640401 TGAATGAGTGGGTGGTTGGATGG + Intronic
969383858 4:6829394-6829416 TGAATCAGTTATTAGTTGGGTGG + Intronic
969492307 4:7506478-7506500 TGAATGAGTGGGTGGGTGGGTGG - Intronic
970221670 4:13818246-13818268 AGAAGGAGGTTGTAGCTGGGTGG + Intergenic
970346092 4:15153607-15153629 TGGTTGAGTTTGTAGATGGTGGG - Intergenic
971207289 4:24583637-24583659 CGACTGAGTTTATAGTTTGGCGG - Intronic
973010829 4:45070410-45070432 TGAATGAGTTAAGAGTTTGGGGG + Intergenic
975665352 4:76729367-76729389 TGAAGGAGTCTGTAGTCAGGTGG - Intronic
977846402 4:101772970-101772992 TTAATGAGTTGGGGGTTGGGTGG + Intronic
978296915 4:107216060-107216082 TGATTATGTTTGTAATTGGGTGG - Intronic
978338030 4:107690537-107690559 TGAAGGAGTTGGTAGTCTGGTGG - Intronic
978553145 4:109949460-109949482 TGAATGAGTTTTTTCTTGAGTGG + Intronic
979175787 4:117660857-117660879 TGAAACAGTTGGTAATTGGGAGG - Intergenic
979956692 4:126961884-126961906 TGAGTGGGTTTGAATTTGGGTGG - Intergenic
981902561 4:149883887-149883909 TCAAGGAGTTTGTAGCTGAGTGG + Intergenic
984686190 4:182671102-182671124 TGAATGGGTTTGTCGTGGGAGGG - Intronic
985438406 4:189958272-189958294 TGCATCAGTTTGTAGATGTGCGG + Intronic
985637302 5:1043305-1043327 TGAATGGGTTTGTGAATGGGTGG + Intergenic
987387247 5:17341810-17341832 TGGATGAGTTTGTAGGCTGGGGG + Intergenic
988783191 5:34541996-34542018 TGAGTGAGTTTCTGGGTGGGGGG + Intergenic
990038884 5:51355605-51355627 AGAATGAGTTGGTCATTGGGTGG + Intergenic
992239341 5:74750056-74750078 TGAATGAGCTTTTAGCTGGCAGG - Intronic
992746783 5:79828132-79828154 TGAAAGAGTTACTAGTTTGGTGG - Intergenic
994141438 5:96346068-96346090 TGATGGAGTTTGCATTTGGGTGG + Intergenic
995916415 5:117250740-117250762 TAAATTAGTTTGAACTTGGGCGG - Intergenic
996702538 5:126464752-126464774 TGGATGAGTAGGTGGTTGGGGGG + Intronic
996973732 5:129405038-129405060 TGACAGAGTTTTTAGTTGTGTGG + Intergenic
997723056 5:136096234-136096256 TGTGTGTGTGTGTAGTTGGGGGG + Intergenic
997741386 5:136258039-136258061 TGAATGAATTTGGAGTTTGGAGG + Intronic
998258747 5:140611398-140611420 TGTATGAGTGTGAAGTTTGGTGG + Intergenic
999588167 5:153114505-153114527 TGTATGTGTGTGTAGTGGGGCGG + Intergenic
1000683594 5:164219131-164219153 TGTGTGAGTTTGGAGGTGGGTGG - Intergenic
1001402105 5:171451644-171451666 TGGATGGGTTTGGAGCTGGGTGG - Intronic
1002439094 5:179254968-179254990 TGAATGAGTGTGTAGATGAATGG + Intronic
1004588492 6:17026091-17026113 TGAATGAGTTAGGACTTTGGGGG + Intergenic
1007955911 6:45917706-45917728 GGAATGAGTTGGCAGGTGGGAGG - Intronic
1013527498 6:110988079-110988101 TGCATGTGTCTGTACTTGGGAGG + Intronic
1017107184 6:150898754-150898776 AGAATGTGTATGTAGATGGGGGG - Intronic
1017821636 6:158053516-158053538 TGAATCAGTGTGCAGGTGGGTGG - Intronic
1018539207 6:164859817-164859839 TGAAAGAGATTGCAGTTTGGGGG + Intergenic
1019489646 7:1306238-1306260 TGAATGTGTGTGTGGGTGGGTGG - Intergenic
1019704505 7:2491123-2491145 TGAATGAGTGGATAGATGGGTGG - Intergenic
1021276210 7:18654800-18654822 TCAATGTGTGTGAAGTTGGGAGG - Intronic
1021875881 7:25048707-25048729 TGCATGAGTTTGTAGTGTTGAGG - Intergenic
1023129008 7:36983864-36983886 TGAATGCGTTTTTAGGTGGGGGG + Intronic
1023464761 7:40441913-40441935 TGAGTGAGTTTCTGGGTGGGGGG + Intronic
1027163752 7:75820633-75820655 TGGATGAGTGGGTAGATGGGTGG - Intronic
1029116954 7:98242530-98242552 TGGATGGGTGTGTAGGTGGGTGG - Intronic
1030799305 7:113829549-113829571 TGAATGAGATTGTAGTTGATTGG - Intergenic
1031804412 7:126291318-126291340 TGATTAAGTTTGTAGTCTGGTGG + Intergenic
1031932536 7:127700668-127700690 TGAATGTGTAAGTAGTTGGGGGG + Intronic
1032613277 7:133439601-133439623 TGAGTGTGTTTGTATTTGTGAGG + Intronic
1032681330 7:134186932-134186954 TGAATGAGTTTGTAGTTGGGAGG - Intronic
1035334880 7:158121421-158121443 TCAATGAGTTTGCAGTTTGTAGG - Intronic
1037865293 8:22438501-22438523 TGAACGAGTTAGTATTTGTGGGG + Intergenic
1038541301 8:28392254-28392276 TCATTGAATTTGTAGTTGAGTGG - Intronic
1041106670 8:54451432-54451454 TGAATGAGTGTGAAGTAGAGGGG + Intergenic
1042028541 8:64449311-64449333 AGAAGGAGTTTGTAATTGTGAGG + Intergenic
1043324196 8:79029638-79029660 TGCATCTGTGTGTAGTTGGGGGG + Intergenic
1044333979 8:90954357-90954379 TGAATGATTTTATACTTGAGAGG - Intronic
1046470689 8:114670068-114670090 TGAATGAGTCTTTGTTTGGGGGG + Intergenic
1047155475 8:122312907-122312929 TGAGTGAATTGGTGGTTGGGAGG - Intergenic
1047215941 8:122876091-122876113 TGGATGAGTGAGTAGGTGGGTGG - Intronic
1047683462 8:127278768-127278790 TTAATGAGTTTGTATTAGGAGGG + Intergenic
1049008341 8:139871864-139871886 TGAATGAGTTAGTGGGTGGCTGG + Intronic
1049223485 8:141438592-141438614 TGAATGAGTGAGTAGATGGATGG + Intergenic
1051175049 9:14352310-14352332 TTTATGAGTGTGGAGTTGGGAGG + Intronic
1051466577 9:17384837-17384859 GCAATGAGTTAGTTGTTGGGTGG - Intronic
1051580273 9:18665451-18665473 TCACTGAGTTTGAAGTTGGAAGG - Intronic
1053047000 9:34927935-34927957 TTAATGAGTTGGGAGCTGGGGGG + Intergenic
1054145277 9:61557132-61557154 TGAATGAATTGATAGGTGGGTGG - Intergenic
1054188339 9:61969847-61969869 TGAATGAATTGATAGGTGGGTGG + Intergenic
1054452017 9:65408372-65408394 TGAATGAATTTGTGGGTGGCTGG - Intergenic
1054464960 9:65487989-65488011 TGAATGAATTGATAGGTGGGTGG - Intergenic
1054465035 9:65488285-65488307 TGAATGAATTGATAGGTGGGTGG - Intergenic
1054650186 9:67618774-67618796 TGAATGAATTGATAGGTGGGTGG - Intergenic
1057035923 9:91811604-91811626 TGCATGAGGAGGTAGTTGGGTGG - Intronic
1057834950 9:98437302-98437324 TGGATGAGTTTGTGGGTGGAAGG - Intronic
1057834994 9:98437569-98437591 TGGATGAGTTTGTGGGTGGATGG - Intronic
1057835024 9:98437746-98437768 TGGATGAGTATGTAGGTGGATGG - Intronic
1059882454 9:118706624-118706646 TGAAGTAGTTTGAAGTTTGGAGG + Intergenic
1061115086 9:128605256-128605278 TGAATGAGCTTGCAGTAAGGGGG - Intronic
1061387588 9:130299631-130299653 TGAATGAGTGGGTAGATGGATGG - Intronic
1062221412 9:135418065-135418087 TGATTGAGTGTGTTGGTGGGTGG + Intergenic
1062368444 9:136223543-136223565 TGAATGAGCTTGGCGGTGGGAGG - Intronic
1062443140 9:136582268-136582290 TGAATGAGTTTGTGAATGAGTGG - Intergenic
1185581682 X:1214615-1214637 TGGATGAGTGTGCAGTTGTGTGG + Intergenic
1185583169 X:1226502-1226524 TGGATGAGTTGGTGGGTGGGTGG + Intergenic
1185616187 X:1423672-1423694 TGGATGAGTGGGTAGATGGGTGG - Intronic
1185624962 X:1474827-1474849 TGTATGGGTGTGTAGATGGGTGG + Intronic
1185625064 X:1475268-1475290 TGGATGAGTGGGTAGATGGGTGG + Intronic
1185656716 X:1691327-1691349 TGTATGAGTTTGAAGTTTGGTGG + Intergenic
1185760149 X:2684402-2684424 TGAATGAGTTGATAGATGGAGGG - Intergenic
1187196584 X:17091630-17091652 TAAATGAGCTTGTATTTCGGGGG + Intronic
1188439403 X:30200519-30200541 AGAATGAGTTAGGAGTTAGGAGG - Intergenic
1188544404 X:31287895-31287917 TGAAGGAGTCTTTAATTGGGAGG - Intronic
1188656946 X:32709156-32709178 TTATTGTATTTGTAGTTGGGAGG - Intronic
1192208803 X:69113842-69113864 TGAAAGATTTTCTAGTTGGGTGG - Intergenic
1192231541 X:69268691-69268713 TGAATGAGTTAATATTTGGAAGG + Intergenic
1193215472 X:78858451-78858473 TGAAGGAGTTTCCAGGTGGGAGG + Intergenic
1193233835 X:79082119-79082141 TGAATGAGTGTCTGGTGGGGGGG - Intergenic
1193502525 X:82297488-82297510 TCAATGAGGTTGTGGTGGGGAGG - Intergenic
1194198307 X:90923830-90923852 TGAAAGAGTGTGGAGTTGGCAGG + Intergenic
1196500207 X:116372115-116372137 TGAAGTAACTTGTAGTTGGGAGG + Intergenic
1196681822 X:118477159-118477181 TGAATGAGTCTGCAGTTCAGAGG + Intergenic
1196726629 X:118901428-118901450 TGTATATGTCTGTAGTTGGGAGG - Intergenic
1198022720 X:132675085-132675107 TGAAAGAGAGAGTAGTTGGGAGG + Intronic
1198619096 X:138487481-138487503 TGAATTGGTTTTTAGTTAGGGGG + Intergenic
1198629156 X:138616123-138616145 TGAATGAGTTAATACTTTGGGGG - Intergenic
1198709081 X:139481746-139481768 TGAATGATTTTGCAATTAGGAGG - Intergenic
1199720960 X:150542510-150542532 TGAATGAGTATGTGGATGGATGG + Intergenic
1200543428 Y:4488998-4489020 TGAAAGAGTGTGGAGTTGGCAGG - Intergenic
1201109808 Y:10790928-10790950 TGGATTGGTGTGTAGTTGGGTGG - Intergenic
1202347528 Y:23948990-23949012 TGTATGATTTTGTGTTTGGGGGG + Intergenic
1202523244 Y:25721101-25721123 TGTATGATTTTGTGTTTGGGGGG - Intergenic