ID: 1032684324

View in Genome Browser
Species Human (GRCh38)
Location 7:134216120-134216142
Sequence CCCCATAAAAATACTGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032684324 Original CRISPR CCCCATAAAAATACTGAGGT AGG (reversed) Intronic
904855681 1:33496709-33496731 CCCCATGCCAAGACTGAGGTGGG + Intergenic
906230029 1:44154224-44154246 CCCCTTAAAACTATTCAGGTGGG - Intergenic
908076655 1:60526784-60526806 CTCCATAAAAATACTTACTTAGG - Intergenic
908947855 1:69522118-69522140 GCCCACAACAATACTGAGGCAGG - Intergenic
909590539 1:77343681-77343703 CCTCATAATCACACTGAGGTAGG - Intronic
910186986 1:84554299-84554321 CCTCATAAAAATAATGTAGTTGG + Exonic
911960298 1:104293374-104293396 ATTCATAAAAATTCTGAGGTAGG + Intergenic
913574702 1:120160566-120160588 GGCCATCAAAGTACTGAGGTAGG + Intronic
914295971 1:146325406-146325428 GGCCATCAAAGTACTGAGGTAGG + Intergenic
914557011 1:148776192-148776214 GGCCATCAAAGTACTGAGGTAGG + Intergenic
914615823 1:149354038-149354060 GGCCATCAAAGTACTGAGGTAGG - Intergenic
915322504 1:155063516-155063538 CTCCCTAAAAATACTGCTGTTGG + Intergenic
916594559 1:166231600-166231622 CCCAATTAAAATACAGAGGACGG - Intergenic
917415127 1:174800970-174800992 CCACCTAAAAATACTTTGGTAGG + Intronic
922113687 1:222588961-222588983 CCCCACAGCAATCCTGAGGTGGG + Intronic
922415599 1:225419710-225419732 CCTCATAAAAATACACAGGTGGG - Exonic
924155962 1:241176842-241176864 CTCCTCAGAAATACTGAGGTTGG + Intronic
1068522452 10:58093046-58093068 CCCCATACAAAGACAGAGGGAGG + Intergenic
1069688148 10:70332341-70332363 CTCCATAAAAAGACTAAGGCAGG + Intronic
1071221465 10:83470941-83470963 TCCTCAAAAAATACTGAGGTCGG + Intergenic
1071687386 10:87774299-87774321 CCTCATAACAGTTCTGAGGTAGG + Intronic
1074966937 10:118499260-118499282 CCTCATAAAAATCCTGAGAGAGG - Intergenic
1075898708 10:126020576-126020598 CCTCATAACAATGCTGAGATAGG - Intronic
1079806991 11:24944290-24944312 CCTCATCTGAATACTGAGGTTGG - Intronic
1082180947 11:49118859-49118881 CCATATAAAAATACTTATGTTGG + Intergenic
1086077560 11:82870692-82870714 CTCCATAAAGCTCCTGAGGTTGG + Intronic
1086684547 11:89716015-89716037 CCATATAAAAATACTTACGTTGG - Intronic
1086745151 11:90416313-90416335 CCTCATAAACATACTGTTGTGGG + Intergenic
1088747957 11:112820340-112820362 TCCCATAAAAAACCTCAGGTAGG + Intergenic
1090360168 11:126166536-126166558 CCCCGTGTAAATCCTGAGGTTGG + Intergenic
1090564550 11:127974011-127974033 CCCAATTAAAATATTGAGATTGG + Intergenic
1090904402 11:131062605-131062627 ACGTATAAAAATGCTGAGGTCGG + Intergenic
1090909832 11:131109359-131109381 TGCCCTAAAAATACAGAGGTGGG + Intergenic
1093627267 12:21364029-21364051 CCTCATAAAATGACTGAGGGAGG - Intronic
1098751994 12:74305130-74305152 CCCCAGTAAAATGCTGAGTTTGG + Intergenic
1099373389 12:81865996-81866018 CACCATAAAAGTACTCAGATGGG + Intergenic
1099402628 12:82218868-82218890 CCACATAATAATAATGAGGGAGG - Intergenic
1099650936 12:85427357-85427379 CCCCATATACATAATGAGATTGG + Intergenic
1099695916 12:86019247-86019269 CTCCATAAAACTCATGAGGTAGG + Intronic
1102256351 12:111417745-111417767 CCCTATATAAAGGCTGAGGTCGG - Intronic
1103260495 12:119584368-119584390 TCCCATAAATTTCCTGAGGTCGG + Intergenic
1104194019 12:126513486-126513508 ACACATAAAGAAACTGAGGTGGG + Intergenic
1104204227 12:126621146-126621168 CACGATGAAAATACAGAGGTGGG + Intergenic
1107670243 13:42738281-42738303 AACCATTAAAATATTGAGGTAGG - Intergenic
1109363838 13:61329965-61329987 CACCATAAAAATACTCAGGGTGG - Intergenic
1111660845 13:91208762-91208784 CCTCATAAAAACCCTGAGGTAGG + Intergenic
1113174919 13:107552619-107552641 ACCCTTAGAAAGACTGAGGTGGG - Intronic
1113204838 13:107905382-107905404 CCACATAAAAAGAGTGAGATGGG + Intergenic
1113287049 13:108861501-108861523 CCCCATAGAAGTACTTATGTGGG - Intronic
1116648430 14:47559866-47559888 CACCATAAAAATACTTGGCTGGG - Intronic
1119338398 14:73853659-73853681 CCCCAAAAAAACTGTGAGGTTGG - Intronic
1126746942 15:51835764-51835786 CTACATAAGAATAATGAGGTTGG - Intronic
1128815485 15:70605168-70605190 TCCCATAAAAATACCAAGGGAGG - Intergenic
1131193495 15:90336116-90336138 GCCATTAAAAATAATGAGGTTGG - Intergenic
1134659949 16:15976542-15976564 CCCCATAAACACCCTGGGGTGGG + Intronic
1135142516 16:19933855-19933877 CCCCACAAGAATCCTCAGGTGGG - Intergenic
1140172860 16:72625412-72625434 ACTCATGAAAACACTGAGGTAGG - Intergenic
1140713405 16:77699213-77699235 AACCATAAAAATAATCAGGTAGG + Intergenic
1141880843 16:86858128-86858150 ACTCATAAAAATACTGAGCCTGG - Intergenic
1149182011 17:53950849-53950871 CCCCAGTGAAATACTTAGGTGGG - Intergenic
1150043372 17:61887146-61887168 CCTCATAACAATTCTGAGATAGG - Intronic
1152541312 17:80977769-80977791 CCCCAGAAAAATACTCAGTAAGG - Intergenic
1153702494 18:7711001-7711023 TCTCATCAAAATACTGATGTGGG + Intronic
1154005426 18:10523520-10523542 CCCCATACAGAGACAGAGGTAGG + Intergenic
1156170279 18:34474769-34474791 ATCCATCAAAAAACTGAGGTTGG - Intergenic
1156372131 18:36480964-36480986 CTGCATAAAAAAACTGTGGTTGG - Intronic
1156658177 18:39312177-39312199 CCCCACAAAAAAAGGGAGGTGGG + Intergenic
1164394734 19:27852601-27852623 CCCCATAGAATGTCTGAGGTCGG - Intergenic
1164396274 19:27866481-27866503 CCCCTTAGAATTCCTGAGGTCGG - Intergenic
1166179990 19:41102172-41102194 CCCCATAAAATGACTTAGGGAGG - Intergenic
1167255952 19:48428843-48428865 CCTCATAAAAAATCTTAGGTGGG + Intronic
1167445652 19:49535687-49535709 CCACAAAAAAATACTTAGCTGGG + Intronic
925670039 2:6301537-6301559 CCCCATATCAATCCTGTGGTTGG + Intergenic
930718503 2:54615856-54615878 CCCCAGAAAAATACTGAGTTCGG - Intronic
931121532 2:59225588-59225610 GGCCCTAAAAATACTGAGGAGGG + Intergenic
931237379 2:60422808-60422830 CCACTTAATAATACTTAGGTGGG - Intergenic
931399889 2:61921741-61921763 CCCCAAAATAATACTGGGTTGGG - Intronic
932395750 2:71446318-71446340 CACCCTAAAACTACTGAGGAGGG + Intergenic
933569968 2:83998733-83998755 CCTCATAAAGAAACTTAGGTTGG - Intergenic
934562844 2:95322062-95322084 GGCCATAAGAATAATGAGGTTGG + Intronic
936599573 2:113882531-113882553 AGACATAAAAATACTGATGTCGG - Intergenic
938510732 2:131940375-131940397 CACACTAGAAATACTGAGGTCGG - Intergenic
942901622 2:181126773-181126795 GCCCATAAAACTACTGAGCTGGG + Intergenic
943570068 2:189563945-189563967 TCCCATCAAAATACTGAGGATGG + Exonic
944344828 2:198650201-198650223 TCCCATAAAGATCCTGAGCTCGG + Intergenic
945478856 2:210321031-210321053 CCCCACAACAATTCTGAGGTAGG + Intergenic
1168785546 20:536434-536456 CCTCACAAAAATCCTGAGGTAGG + Intronic
1169537576 20:6561581-6561603 CCGAATATAAATACTGAGTTTGG - Intergenic
1170326480 20:15159910-15159932 TCCCAGGAAAATACTGAGGAAGG + Intronic
1170374519 20:15685838-15685860 CCCCATCAAAGTGATGAGGTCGG - Intronic
1170703050 20:18721559-18721581 CCTCATAAAATTAATGAGTTGGG + Intronic
1175206117 20:57312778-57312800 CCTCATAATAATCTTGAGGTGGG + Intergenic
1176783099 21:13222924-13222946 CACACTAGAAATACTGAGGTTGG + Intergenic
1177980739 21:27911721-27911743 CACACTAGAAATACTGAGGTTGG + Intergenic
1178515569 21:33244385-33244407 CCCCACAACAATGCTGAAGTAGG - Intronic
1178792940 21:35716960-35716982 AACCCTAAAAATATTGAGGTTGG + Intronic
1180731345 22:17984782-17984804 CCTCACAAAAATTCTGAGTTAGG + Intronic
1181516378 22:23415998-23416020 CCTCATGAAAATTCTGAGTTAGG + Intergenic
949665026 3:6328765-6328787 CCCAAAAAAAAGACTTAGGTAGG + Intergenic
949859681 3:8493990-8494012 CCCCATGAAAATACTGATGGTGG + Intergenic
950378177 3:12589267-12589289 TACCAGAAAAACACTGAGGTAGG + Intronic
951511523 3:23507759-23507781 CCCCTCAAAAATACTTGGGTTGG - Intronic
951544710 3:23812742-23812764 CACCATCAAAATAATGAGTTAGG - Intronic
953328497 3:42032700-42032722 CCCCATAAAACAAGTGTGGTAGG + Intronic
957393054 3:79603627-79603649 CCTCATAAAACCACTGAGATTGG + Intronic
957843937 3:85706234-85706256 ACCCATGATAATACTGAAGTGGG - Intronic
959402010 3:105914147-105914169 CCTCATAATAACACTGAGTTTGG - Intergenic
960346902 3:116544442-116544464 AGCCATAAAAATAATGAGGTCGG + Intronic
962877619 3:139547805-139547827 GCCCATAAAAGGACTGAAGTGGG + Intergenic
965604811 3:170487311-170487333 AACAATGAAAATACTGAGGTGGG - Intronic
968378519 4:66639-66661 CCATATGAAAAAACTGAGGTTGG - Intronic
968696128 4:2029021-2029043 CCCCATAAAATTAGTTAGGGAGG + Intronic
970070798 4:12157649-12157671 CCCCATAAAATGAGTGAGGGAGG + Intergenic
970395087 4:15656749-15656771 CCTCATAAAGATTCTGAGGTAGG - Intronic
971019302 4:22517384-22517406 CCCCATAAGAAGAGTCAGGTTGG + Intergenic
972149679 4:36073684-36073706 GCCCGGAAAAATATTGAGGTAGG - Exonic
973261040 4:48163956-48163978 CTCCATAAAAATTCTGCGGTAGG + Intronic
975230055 4:71922705-71922727 CCTCATTACAACACTGAGGTAGG + Intergenic
976224301 4:82782904-82782926 CCACACAACAATACTGAGGTGGG + Intronic
977803545 4:101268422-101268444 CACCATAAAAACTGTGAGGTTGG - Intronic
978803628 4:112778268-112778290 CAGCATAAAAATACTGGGATTGG - Intergenic
981327882 4:143472658-143472680 CCCTCTAATAATGCTGAGGTGGG + Exonic
985578622 5:685233-685255 CCCCATAGAAGACCTGAGGTCGG + Intronic
986065549 5:4230620-4230642 CCCCATAATAAGACTGTTGTGGG - Intergenic
987116064 5:14727824-14727846 CCCTTTAAAAATGGTGAGGTTGG + Intronic
987907151 5:24091493-24091515 CCACATAAGAAAACTGAGGCAGG + Intronic
988393594 5:30668178-30668200 CCTCATAACAATTCTGAGCTTGG - Intergenic
988916719 5:35901776-35901798 ACCCATAACAATACTGAATTTGG - Intergenic
990002116 5:50906549-50906571 CTCCATATAAATGCTGAAGTTGG - Intergenic
992981184 5:82174941-82174963 CCCCTTAAAAAAACTGAGGAAGG - Intronic
996082369 5:119269781-119269803 CCCCATAAAAATAATTATGTAGG - Intronic
997904963 5:137807419-137807441 CCCTAAAAAAATACAGAAGTTGG + Intergenic
999737045 5:154520865-154520887 CCTCTGAAAAATCCTGAGGTGGG + Intergenic
1000269946 5:159674500-159674522 CTCTATAAAAATACAGAAGTTGG + Intergenic
1000443910 5:161296774-161296796 CTCCAAAATAATACTGGGGTTGG + Intronic
1001075501 5:168624530-168624552 CTCCATGAAAATACTGTTGTAGG - Intergenic
1001403174 5:171458518-171458540 CCCCACAAAGACACTTAGGTTGG - Intergenic
1003004577 6:2369065-2369087 CCCTAGAAAAAAACCGAGGTAGG + Intergenic
1003136938 6:3441140-3441162 CCCCATCACAAAACTGTGGTAGG - Intronic
1004361823 6:14978028-14978050 CACTATAAGAATAATGAGGTTGG - Intergenic
1004593596 6:17077388-17077410 CCCCATAAAATGAGTGAGGGAGG - Intergenic
1006442253 6:34059923-34059945 CCACAAAAAGAGACTGAGGTAGG + Intronic
1006696335 6:35933476-35933498 CTGCACAAAAATCCTGAGGTAGG - Intergenic
1012007002 6:93725614-93725636 CCCCATCTTAATACTGAGGAAGG - Intergenic
1014700803 6:124685486-124685508 CCTCATAAAAATACCAAAGTTGG - Intronic
1018301440 6:162406861-162406883 CTAAATAAAAATACTGGGGTGGG - Intronic
1020381264 7:7549516-7549538 CCCCATCATAACACTGAGATGGG - Intergenic
1021227408 7:18044256-18044278 CCACATAAAATTACTGAAATGGG + Intergenic
1026203727 7:68237427-68237449 CCCCGAAAAAAAACTGTGGTAGG - Intergenic
1027979170 7:85195313-85195335 CCCCATAAATACAGTGGGGTAGG + Intergenic
1028370547 7:90087183-90087205 CACCAGGAAAACACTGAGGTGGG - Intergenic
1029996170 7:105010615-105010637 CTCAATAAAAATACTAAGCTTGG - Intergenic
1032684324 7:134216120-134216142 CCCCATAAAAATACTGAGGTAGG - Intronic
1032733453 7:134667410-134667432 CACTATAAAAATATTGAGCTGGG + Intronic
1033940357 7:146644963-146644985 CCTCATAAAATGACTGAGGGAGG - Intronic
1035715709 8:1753229-1753251 CCTAATAAAAATAATGAGGTGGG - Intergenic
1036005363 8:4656171-4656193 CCCCATAAGAACACTGAGGAAGG + Intronic
1036450103 8:8858629-8858651 CCCCATATATATACCGAGGGAGG - Intronic
1037340544 8:17839990-17840012 GCCCATGAAAATACAGATGTGGG + Intergenic
1038148628 8:24921871-24921893 CCCCACAAAAATAGTTAGCTGGG - Intergenic
1038461360 8:27720090-27720112 CCCCATAAAATAACTGCAGTTGG + Intergenic
1040664519 8:49617502-49617524 CCACCTAAAAAGAATGAGGTAGG - Intergenic
1042859443 8:73297625-73297647 CCTCTCAAAAATACTGAGTTAGG - Intronic
1043351425 8:79365404-79365426 TCTCATAACAATACTGTGGTAGG - Intergenic
1043594100 8:81864068-81864090 CACCAGAAAAATACTCAGGTGGG - Intergenic
1044625690 8:94233738-94233760 CCCCCTAAAAAAACTGTGGCCGG + Intergenic
1045215756 8:100146692-100146714 ACTAATAAAAATGCTGAGGTAGG - Intergenic
1045259075 8:100556319-100556341 GCCCATAAAAATGCTTGGGTGGG - Intronic
1045494719 8:102698774-102698796 CCTCATGACAATACTGAGGGTGG - Intergenic
1047390799 8:124449414-124449436 CTCCATAATAAGACTGAGGCAGG - Intergenic
1048906124 8:139091056-139091078 CCCTATCAAAATACTGATGTTGG - Intergenic
1050328690 9:4523018-4523040 TTCCATAAAAATCCTGAGATAGG + Intronic
1050921826 9:11213252-11213274 TCCATTAAAAATACTGAGGCAGG + Intergenic
1052791055 9:32876050-32876072 GCACATGAAACTACTGAGGTGGG - Intergenic
1054838189 9:69702650-69702672 CCACATAAATATAATGAAGTGGG - Intergenic
1055278229 9:74643596-74643618 TGCCATAAAAATATTGAAGTAGG + Intronic
1055351615 9:75394733-75394755 CCTCATAAAAATACTGTATTAGG + Intergenic
1055772869 9:79736335-79736357 CTCCATAGAAATACTGCCGTGGG + Intergenic
1056534982 9:87519282-87519304 CCCTATAAAAAGACTGCTGTTGG + Intronic
1058440472 9:105001981-105002003 GCCATTAAAAATAATGAGGTAGG + Intergenic
1059046632 9:110875817-110875839 CAATATAAAAATACTGAAGTTGG + Intronic
1059290587 9:113220875-113220897 TCCTATAAAAATTCTGAGGCAGG + Intronic
1059857708 9:118418617-118418639 TCCCATCAGAATACAGAGGTTGG - Intergenic
1062214990 9:135384324-135384346 CCGCATAAAAGGACTGAGGCAGG - Intergenic
1203570720 Un_KI270744v1:127611-127633 CCATATGAAAAAACTGAGGTTGG + Intergenic
1188895732 X:35666049-35666071 CACCAAAAAATTACTGAGGTAGG - Intergenic
1191229351 X:58081854-58081876 CCCCTTAGAATTCCTGAGGTTGG - Intergenic
1191244209 X:58213122-58213144 TCCCATTAGAATACTGAGGTCGG - Intergenic
1193026667 X:76852272-76852294 CCCCATCAAAATCTTAAGGTGGG - Intergenic
1193037832 X:76972736-76972758 CCCCATAAGATATCTGAGGTGGG - Intergenic
1193843475 X:86438525-86438547 ACCCATAAAAAGAATGAGTTCGG - Intronic
1194528571 X:95012873-95012895 GCCCATAAAAACACTGATTTTGG - Intergenic
1194807823 X:98351199-98351221 GCCCATGCAAAGACTGAGGTGGG + Intergenic
1195395171 X:104402615-104402637 CCCAATAACAATAATGAGCTTGG - Intergenic
1197961257 X:132008599-132008621 CCCTATAAAAATTCTGGGCTGGG - Intergenic
1200280765 X:154775082-154775104 CACCATCAAAATACTGACGCTGG - Intronic
1202327176 Y:23703947-23703969 CCCCAAGAAAAATCTGAGGTGGG + Intergenic
1202543594 Y:25966105-25966127 CCCCAAGAAAAATCTGAGGTGGG - Intergenic