ID: 1032687735

View in Genome Browser
Species Human (GRCh38)
Location 7:134252659-134252681
Sequence GCCCATGTGCTGCTGGGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 2, 2: 3, 3: 29, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032687735_1032687739 -7 Left 1032687735 7:134252659-134252681 CCTATGCCCAGCAGCACATGGGC 0: 1
1: 2
2: 3
3: 29
4: 216
Right 1032687739 7:134252675-134252697 CATGGGCTTTCCAGGAGAGCTGG No data
1032687735_1032687741 -1 Left 1032687735 7:134252659-134252681 CCTATGCCCAGCAGCACATGGGC 0: 1
1: 2
2: 3
3: 29
4: 216
Right 1032687741 7:134252681-134252703 CTTTCCAGGAGAGCTGGGTTTGG 0: 1
1: 1
2: 1
3: 28
4: 247
1032687735_1032687740 -6 Left 1032687735 7:134252659-134252681 CCTATGCCCAGCAGCACATGGGC 0: 1
1: 2
2: 3
3: 29
4: 216
Right 1032687740 7:134252676-134252698 ATGGGCTTTCCAGGAGAGCTGGG No data
1032687735_1032687743 24 Left 1032687735 7:134252659-134252681 CCTATGCCCAGCAGCACATGGGC 0: 1
1: 2
2: 3
3: 29
4: 216
Right 1032687743 7:134252706-134252728 TCCCAAGTGCACCAGTGCTGTGG 0: 1
1: 0
2: 1
3: 22
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032687735 Original CRISPR GCCCATGTGCTGCTGGGCAT AGG (reversed) Intronic
900154406 1:1198224-1198246 GCCCAGGTGCTGAGGGGCACAGG - Intergenic
900405262 1:2490193-2490215 GGCCAGGTGCTGGTGGGAATGGG - Intronic
900647390 1:3715152-3715174 GCCCTGGTCCTGCTGGGGATGGG - Intronic
901428972 1:9200908-9200930 GCCCAGGTGGTCCTGGGCACTGG - Intergenic
901438687 1:9264552-9264574 GACCTGGTGCTGCTGGGCATGGG + Exonic
901510781 1:9717168-9717190 CTCCATGTGCTACTGGCCATGGG + Intronic
902118260 1:14139686-14139708 GCCCATGCCCTGCTGGGCACTGG - Intergenic
903071168 1:20727595-20727617 GCCCACGTACTGCTCGGCAGTGG + Exonic
903344761 1:22677149-22677171 GCCCATCTGCTCCTGGGGAGCGG + Intergenic
904331711 1:29762258-29762280 GCCCAGGTGTTGCTGTGCTTGGG + Intergenic
909347490 1:74608975-74608997 GCCCATCTGCTGAAGGGAATTGG + Intronic
910263560 1:85314654-85314676 GTCCTTGTCCTGCTGGGCCTAGG + Intergenic
910479385 1:87641711-87641733 TCCCTAGTTCTGCTGGGCATGGG - Intergenic
913551283 1:119919363-119919385 GCCCATGTTGTCCTGGGCATTGG + Exonic
914854896 1:151343689-151343711 GCCCATGTGCTTAAGGCCATGGG - Exonic
915229463 1:154434860-154434882 GCCCTTGTGGAGCTGTGCATGGG + Intronic
917507470 1:175640931-175640953 GCCTATGTGCTGCTGGAAAAAGG + Intronic
922033852 1:221829263-221829285 GCCCATGTGAAGATGGGCACTGG - Intergenic
923502676 1:234578972-234578994 GCCCACGTGCTCCTGGGCCCTGG - Intergenic
924123146 1:240823384-240823406 GCCCAAGTGGTGCGGGGCTTCGG - Intronic
1062855709 10:778544-778566 GCCCGTGTGCTGCGGGGCTGAGG - Intergenic
1062995299 10:1860313-1860335 CCACATGTTCTGCTGGGCAGGGG - Intergenic
1064602966 10:17011953-17011975 CCCCAACTGCTGCTGGGAATTGG + Intronic
1064900546 10:20291225-20291247 GCATATGTGCTGATGGGCTTGGG - Intergenic
1065890314 10:30115792-30115814 GCCTATGTGGTCCTGGGCTTTGG + Intergenic
1066622808 10:37375873-37375895 GACCATCTTCTGCTGGGCATTGG - Intronic
1067343841 10:45424166-45424188 GCCCAAGTGGTGCTGGGGACAGG + Intronic
1067810829 10:49426003-49426025 GAGCCTGGGCTGCTGGGCATGGG - Intergenic
1069718940 10:70538053-70538075 GTCCCTGAGCAGCTGGGCATAGG + Intronic
1069789980 10:71013221-71013243 TCCCATGTGATGCTGGGCACAGG - Intergenic
1069921459 10:71818164-71818186 GCCCTAGGGCTGCTGGGCAGGGG + Intronic
1070778075 10:79121705-79121727 GCCAAGGTTCTGCTTGGCATGGG + Intronic
1073318105 10:102597022-102597044 GCCCTTGTGGTGCTGAGCATGGG - Intronic
1075568453 10:123521242-123521264 GCCCATGTGCCCCTGGGAAGGGG - Intergenic
1076523590 10:131096190-131096212 GCCCATCTTCTCCTGGCCATGGG - Intronic
1076723834 10:132404387-132404409 GGCCATATGCTGCTTGGCTTTGG + Intronic
1080605981 11:33865097-33865119 GCCCAGGTAGTGCTGGGCATGGG - Intronic
1080786245 11:35477925-35477947 ACCCATCTGCTGCTGGGCTACGG + Intronic
1081794816 11:45811907-45811929 CCCCAGGGGCTGCTGGGCAGTGG + Exonic
1084219895 11:67671402-67671424 GCCCACCTGCTGCAGGGCAGGGG + Intronic
1084273900 11:68042373-68042395 GCCCTTGCGCTGCAGGGCTTGGG - Intronic
1084942200 11:72618763-72618785 GCCCATGGGACGCTGGCCATGGG + Intronic
1084943603 11:72627194-72627216 GCCCATGTGGTGCTTGGTATAGG - Intronic
1085509369 11:77080339-77080361 GCCCTCTTGCTGCTGGGCTTGGG + Intronic
1085799080 11:79571209-79571231 TCCCAAGTGCTGCTGGCCATAGG - Intergenic
1086392043 11:86375180-86375202 GCCCAGGTCCTGCAGGGCACGGG - Exonic
1088918388 11:114244119-114244141 GCCCATTTGCTGCTGGGGCCGGG + Intronic
1089565052 11:119366736-119366758 ACACATGTGCTGCTGGGCTTGGG + Intronic
1089778962 11:120859711-120859733 GCCCATGTGCTGTGGGCTATCGG - Intronic
1091080159 11:132658793-132658815 CACCATGGGGTGCTGGGCATTGG - Intronic
1091803992 12:3343014-3343036 TCCCAGGTGCTGCTGGTCTTGGG + Intergenic
1091810136 12:3390045-3390067 CCGCCTGTGCTTCTGGGCATGGG + Intronic
1093809515 12:23474657-23474679 GCACATGTGCTGGTGGGCCCAGG - Intergenic
1096955015 12:55517234-55517256 GGCAATGTGCTGGTGGGCACAGG - Intergenic
1098099795 12:67002928-67002950 TCCAAGGTGCTGCTGGGCAGGGG - Intergenic
1098141432 12:67453802-67453824 CCCCATGTGCTGCTGAGGCTTGG - Intergenic
1101793691 12:107953683-107953705 GCCCATGTTGTGCTGGACCTTGG - Intergenic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1102204513 12:111081401-111081423 CCACATGTGCTGCTTGGCAGTGG - Intronic
1102633534 12:114302513-114302535 TCCAAGGTGCTGCTGGGCCTTGG + Intergenic
1104767952 12:131342554-131342576 CCCCAACTGCTGCTGGGAATTGG + Intergenic
1104874927 12:132027084-132027106 GGCCATGTGCTGATGGCGATGGG + Intronic
1106910113 13:34454334-34454356 TTCCAAGTGCTGCTGGGCCTGGG - Intergenic
1107429429 13:40326875-40326897 GGACATGTGTGGCTGGGCATGGG - Intergenic
1108633582 13:52310736-52310758 TCCCATGTGATGGTGGGTATGGG + Intergenic
1108633980 13:52314427-52314449 TCCCATGTGATGGTGGGTATGGG + Intergenic
1112329739 13:98468164-98468186 TCCCATGGACTGCTGGGCTTGGG - Intronic
1113613566 13:111665030-111665052 GCCCAGGTGGTGCTGGGCTGGGG + Intronic
1113881491 13:113629187-113629209 GCCCATGCAGTGCTGGGCAAGGG - Intronic
1119774089 14:77237803-77237825 ACCCATGCTCTGCTGGGGATGGG + Intronic
1121886601 14:97548741-97548763 GCATATGTGTTGCTGGGCAAAGG - Intergenic
1124866187 15:33493633-33493655 GACCATGTGCTGCCAGGCAGAGG + Intronic
1125658563 15:41378209-41378231 TGCCCTGGGCTGCTGGGCATTGG - Intronic
1127396202 15:58545832-58545854 GCCCATGTGCTCCCGGGTAAAGG - Exonic
1127822877 15:62675528-62675550 GCCCCTGGGCAGCTGGGCTTTGG + Intronic
1129599204 15:76988422-76988444 GCCCAGGAACTGGTGGGCATGGG - Intergenic
1129711489 15:77822514-77822536 GCCCTTGTGCTGGTGGCCAGAGG + Intergenic
1131063512 15:89418615-89418637 GCCCATGTGTACCTGGGCAATGG + Intergenic
1131375058 15:91916359-91916381 GCCCAGGTGCTCCTGGGCATCGG + Exonic
1131786713 15:95921329-95921351 GCCAATGTCTTGTTGGGCATGGG + Intergenic
1132321512 15:100929021-100929043 GTCAATGAGATGCTGGGCATGGG + Intronic
1133039513 16:3052887-3052909 GGCCATGTGCTGAGGGGAATGGG + Intronic
1133043356 16:3072520-3072542 GGCCATGTGCTGAGGGGAATGGG + Intronic
1133283116 16:4678179-4678201 CCCCATGCGCTGCTGTGCAAGGG + Intronic
1135099403 16:19593150-19593172 GCCCCTGTGCTGCTTGGCAGTGG + Intronic
1135952600 16:26929134-26929156 GCTCATGGGATGCTGGACATAGG - Intergenic
1136372997 16:29847840-29847862 GCCTTTGGGCTGCTGGGGATGGG + Exonic
1136609197 16:31356004-31356026 GCCCAGGTGGTGCTGGCCTTTGG + Intronic
1138269485 16:55684981-55685003 GCCCATGTGGTGCATGGCAGTGG + Intronic
1142111295 16:88333036-88333058 GTCCTTGTGCTGCTGCTCATTGG + Intergenic
1142126169 16:88411708-88411730 GCCCAAGTGCTGCAGGGCCTGGG + Intergenic
1143770726 17:9166850-9166872 ACCCATATGCTGCTGGTGATTGG + Intronic
1144634152 17:16893344-16893366 GCTCATGTGCTCCTCTGCATTGG - Intergenic
1144761426 17:17709659-17709681 GCCAAGGAGCTGCTGGGCCTCGG + Intronic
1145168252 17:20633185-20633207 GCTCATGTGCTCCTCTGCATTGG - Intergenic
1146164340 17:30576154-30576176 GCTCATGTGCTCCTCTGCATTGG - Intergenic
1146302456 17:31700191-31700213 GGCCATGATCTGCTGGGCACTGG + Intergenic
1146442358 17:32908149-32908171 GGCCATGTGATGCAGGGCTTGGG + Intergenic
1146535316 17:33645752-33645774 GACTATCTTCTGCTGGGCATTGG + Intronic
1150628408 17:66858625-66858647 AGCAATGTGCTGCTGGGCATCGG - Intronic
1152058651 17:78052066-78052088 GCCCTTGTCCTGCTGGACACAGG - Intronic
1153960367 18:10135074-10135096 GCCCATGTGCTGATGCCCAGGGG + Intergenic
1153961665 18:10145385-10145407 GCCCATGTGCTGATGCCCAGGGG + Intergenic
1157484907 18:48079918-48079940 GCCCAGGGACTGCAGGGCATGGG + Intronic
1157815779 18:50728677-50728699 GCTCTGATGCTGCTGGGCATTGG - Intronic
1160534265 18:79584021-79584043 CCCCGGGTGCTCCTGGGCATAGG + Intergenic
1161459641 19:4389168-4389190 GGCCATGTTCTGCTGGGCACTGG - Intronic
1162033638 19:7927757-7927779 GCCCCTCTGCAGCTGGCCATGGG - Exonic
1162344692 19:10112402-10112424 GCCCCTGTGCTGCTGTGCCCTGG + Intronic
1163602495 19:18257469-18257491 ACCCGTGTGGTGCAGGGCATGGG - Exonic
1164560612 19:29289509-29289531 TCCCATGAGCAGCTGGGCACAGG - Intergenic
1164829752 19:31311397-31311419 GCCAATGTGCTGCTGAGCTCTGG + Intronic
1164977647 19:32585627-32585649 GCCCATGTGGAGATTGGCATGGG + Intronic
1164992421 19:32693876-32693898 CCCCATCTGCTGTTGGGAATTGG + Intronic
925069320 2:954155-954177 GCTCCTGCGCTGCTGGGCATGGG + Intronic
927885290 2:26714481-26714503 GCCCAACTGCTGCTGGGGAGGGG + Intronic
929443608 2:41985711-41985733 GCCCAGGTGCAGGTGGACATTGG + Intergenic
929581344 2:43083362-43083384 GCCCATCTGCTCCAGGGCCTTGG + Intergenic
929789235 2:45011411-45011433 GCCCCTGTGCAGCAGTGCATAGG - Intergenic
931067152 2:58599733-58599755 GCACATGCTCTGCTGGGAATGGG + Intergenic
932079486 2:68698816-68698838 ACCCATCTGCTTCTGGGAATAGG + Intronic
932571364 2:72940159-72940181 GACCAGGTGCTGCTGGGCCAAGG - Intergenic
933721113 2:85398344-85398366 GCCCCTGTGCTGCAGGGATTGGG - Intronic
934655495 2:96115107-96115129 GGCCAGGTGCTCCTGGGCAGGGG - Exonic
935787854 2:106565422-106565444 GCCCAGGTGCTGCCGGGCACAGG + Intergenic
937952662 2:127400842-127400864 GCCCCTCTGCTGCTGGGAACCGG + Intergenic
937996065 2:127695821-127695843 GCTCGCGTGCTGCTGGGGATGGG - Intergenic
939659367 2:144869198-144869220 GCTCATCTGCTTCTGGACATTGG - Intergenic
940897470 2:159094691-159094713 GCCCCTGTGGTTCTGGGGATTGG + Intronic
941243858 2:163072685-163072707 GCCCAACTGCTGTTGGGAATTGG - Intergenic
941537211 2:166739060-166739082 CCCCAACTGCTGCTGGGAATTGG + Intergenic
941962329 2:171266009-171266031 GCACATATACTGCTGAGCATTGG + Intergenic
942178399 2:173355901-173355923 GCCCCGGTGGAGCTGGGCATTGG + Intronic
946331619 2:219012530-219012552 GCCCATGTGTTTCTGAGCAGGGG - Intronic
946375236 2:219303913-219303935 CCCCATGAGCTGCAGGGCAGAGG - Intronic
947574585 2:231262523-231262545 GCTCATGAGGTTCTGGGCATTGG + Intronic
948327728 2:237139985-237140007 CCCCATGCGCTGCTGGGGCTGGG + Intergenic
1168809455 20:694703-694725 ACCAGTGGGCTGCTGGGCATAGG + Intergenic
1168998514 20:2149792-2149814 GCCCAGTGGCTGCTGGGGATGGG + Intronic
1172127997 20:32636651-32636673 CCCCATGTGCTGCTGGACTTGGG + Intergenic
1173321951 20:41996628-41996650 GCCCAGGTGGGGCTGGGCACTGG - Intergenic
1173906452 20:46633267-46633289 GCCAATGTGCTTCTTGGCCTTGG - Intronic
1175264239 20:57692857-57692879 GCCTAAGTGCTGCTGGTAATAGG + Intronic
1176052640 20:63128605-63128627 GCCCATGTGCTTCTGGGGGAGGG - Intergenic
1176191885 20:63815320-63815342 GCACAGGTGCAGGTGGGCATAGG + Intronic
1178109412 21:29355486-29355508 CCCCAACTGCTGCTGGGAATTGG + Intronic
1180009598 21:45040664-45040686 GCCCATGTGCTGCTGGGGATAGG + Intergenic
1180077609 21:45470953-45470975 GGCCGTGTGCTGCTGGGCGTGGG + Intronic
1180077631 21:45471057-45471079 GGCCTTGTGCTGCTGGGCCTGGG + Intronic
1180077640 21:45471092-45471114 GGCCGTGTGCTGCTGGGCCTGGG + Intronic
1180077649 21:45471127-45471149 GGCCTTGTGCTGCTGGGCGTGGG + Intronic
1180077656 21:45471162-45471184 GGCCGTGTGCTGCTGGGCGTGGG + Intronic
1181173107 22:21021362-21021384 CCACTTGGGCTGCTGGGCATAGG + Intronic
1183470097 22:38000616-38000638 GCCCAGGGGCTGCTGGACACAGG + Intronic
1184259783 22:43308005-43308027 GCCCATGGCCTGCTTGGGATTGG - Intronic
1184627017 22:45743085-45743107 GCCCAAGTGCTGCTGTGCAGAGG + Intronic
1185182615 22:49372028-49372050 ATGCACGTGCTGCTGGGCATGGG - Intergenic
1185280358 22:49967231-49967253 GTCCAGGTGCGGCTGGGCCTAGG - Intergenic
950581317 3:13864120-13864142 CGCCATGTGCTCCTGGGGATGGG - Intronic
951875967 3:27425914-27425936 TTCCATGTGTTGCTGTGCATGGG - Intronic
953622364 3:44544076-44544098 CCCCAACTGCTGCTGGGAATTGG + Intergenic
953910849 3:46892321-46892343 GCACATGTATTTCTGGGCATAGG - Intronic
954582308 3:51709509-51709531 GCTCATGGGCTGCTGTGAATTGG + Intronic
954958987 3:54548154-54548176 GCCCATGACCTGCTGGGACTGGG - Intronic
956688461 3:71854439-71854461 GCCCATGGGCTGCTGGGCATTGG + Intergenic
960954540 3:123022634-123022656 TCCAATTTGCTGCTGGGCACAGG - Intronic
962815707 3:138996301-138996323 GCCTATGTCCTGCTTGGAATGGG - Intergenic
964814906 3:160706838-160706860 GCCCAGCTGATGCTGGCCATAGG - Intergenic
967972119 3:195006554-195006576 GCTCATGTGCCGATGGGCTTGGG + Intergenic
968597318 4:1492147-1492169 GCCCCTGTGCTGCTGGTAACAGG - Intergenic
968659092 4:1791900-1791922 GCCAATGTGCTGCTGTGCCTTGG + Intergenic
968729935 4:2264875-2264897 GCCCATGCCCTGCAGGGCTTGGG - Intergenic
968900182 4:3427238-3427260 GCCCAGGGCCTGCTGGGCCTCGG + Intronic
969105639 4:4805287-4805309 GCCCATTTTGTGCTAGGCATGGG + Intergenic
969707241 4:8818707-8818729 GCCCATGTGCTCCTGTGGCTGGG - Intergenic
977357903 4:95969635-95969657 GGACATGTGCTTCTGGGCACTGG - Intergenic
982463994 4:155707482-155707504 TCTCATGTGATGCTGGGCAGTGG - Intronic
985727915 5:1525294-1525316 CCCTGTGTGCTGGTGGGCATTGG + Intergenic
985940495 5:3132014-3132036 CCCCATGGGCTCCAGGGCATTGG - Intergenic
990183892 5:53192020-53192042 TCCCATATGCTGATGGGCAAAGG + Intergenic
990829684 5:59942336-59942358 TCCCATGTGACTCTGGGCATTGG + Intronic
993567369 5:89491667-89491689 GCCCATGTACTGAATGGCATAGG + Intergenic
996350776 5:122539053-122539075 GCCCATTAGCTACTGGGCTTGGG + Intergenic
998349089 5:141489297-141489319 GTCCTTGTGCTGCTGGGGCTGGG + Exonic
998567126 5:143225744-143225766 GCCCATGAGCTGCTGCCAATGGG + Exonic
999475756 5:151897352-151897374 GACCATGAGCTGCTGGACAGAGG + Intronic
999641823 5:153680183-153680205 GGCCATGTGCTGCTGGGGGCTGG - Intronic
1000326945 5:160179422-160179444 CCCCCTCTCCTGCTGGGCATGGG - Intergenic
1001650306 5:173311198-173311220 GGCCCTCTGCTCCTGGGCATGGG + Intergenic
1001906691 5:175478878-175478900 GCCCACGGGATGCTGGGCCTCGG - Intronic
1002439262 5:179255916-179255938 GCACAGATGCTGCTGGGCCTAGG + Intronic
1006125385 6:31834600-31834622 GACCATGGGCTGCTGGGAAACGG + Exonic
1006424705 6:33956703-33956725 GCCAATGAGCTGCTGGGCATTGG - Intergenic
1006515084 6:34541269-34541291 GACCATGTGCTCTTGGGGATGGG + Intronic
1009354587 6:62726925-62726947 GCCCTTTTGCTCCTAGGCATAGG + Intergenic
1011626104 6:89285164-89285186 GCCCAGGTGCTGCTGGGGACTGG - Intronic
1014709126 6:124785782-124785804 GCCTCAGTACTGCTGGGCATTGG + Intronic
1014852832 6:126362255-126362277 GCCCATGAGCTTTTGTGCATAGG - Intergenic
1015019888 6:128460252-128460274 GCCCTTTTCCAGCTGGGCATGGG + Intronic
1015578943 6:134702525-134702547 GCCCAGCTGCTGCTGGGGAATGG + Intergenic
1016563136 6:145419195-145419217 GGCCATGCGCTGCTGGGGAAAGG - Intergenic
1016603736 6:145893242-145893264 GCCCATGAGCTTCAGGCCATAGG - Exonic
1016677915 6:146793382-146793404 CCCCAGCTGCTGCTGGGAATGGG + Intronic
1017137220 6:151158707-151158729 GCCCATGTACTGCTGGCCCCCGG - Intergenic
1019164591 6:170089669-170089691 GCCCATGGGCTCCTGGCCGTGGG - Intergenic
1019430483 7:996725-996747 GACCACGTGCTGCTGGGAACAGG + Intergenic
1019665268 7:2249102-2249124 GCCCAAGTGCTGCTGCGCCTGGG - Intronic
1022380766 7:29857597-29857619 GCCCAGCTGCTGTTGGCCATTGG + Intronic
1023991293 7:45130275-45130297 GGCCATTTGCTGCTGGGAGTGGG - Intergenic
1024602389 7:50995233-50995255 GCCCATGTTCACCTGGGGATGGG + Intergenic
1024981475 7:55161080-55161102 GAGCAGGTGCTGCTGGGCACAGG - Intronic
1026205919 7:68257317-68257339 GCCCATCTCCTTCTGGGTATTGG - Intergenic
1026870278 7:73846865-73846887 GCCCCTGTGCTGCTGACCACTGG - Intergenic
1029539255 7:101173211-101173233 GCCCGTGTTCTGCTGGGGGTGGG + Intronic
1032687735 7:134252659-134252681 GCCCATGTGCTGCTGGGCATAGG - Intronic
1034940798 7:155228918-155228940 GCACATGTGCTGCTGGTGGTTGG - Intergenic
1035203545 7:157280758-157280780 GTCCAGGTGCTGCAGGGCACAGG + Intergenic
1035280061 7:157772847-157772869 TCCCATGTGCTGCTAGGCCACGG + Intronic
1035603199 8:910924-910946 GCCCACTTGCTGCTGGACTTGGG + Intergenic
1037525913 8:19724130-19724152 ACAAATGTGCTGCTGGGCAGCGG - Intronic
1038481798 8:27907090-27907112 GCCCATGTGCTGCCTGGGACTGG + Intronic
1039998918 8:42560258-42560280 CCCCAACTGCTGCTGGGAATTGG + Intergenic
1040077179 8:43247501-43247523 CCCCAGGTGCTGCGGGGCTTCGG - Intergenic
1040542209 8:48370408-48370430 GCTCAGGAGCTGCTGGGCCTTGG + Intergenic
1040795863 8:51289553-51289575 CCCCAACTGCTGCTGGGAATTGG + Intergenic
1043517898 8:81013351-81013373 GCCCAGGTGCAGCTGGATATGGG - Intronic
1043701889 8:83299314-83299336 GCCCATCTGCTTCTGGTCATGGG + Intergenic
1047795848 8:128254811-128254833 TCCCAAATGCTGCTGAGCATAGG + Intergenic
1049641219 8:143716808-143716830 GCCCCTGTGCTCCTGAGCCTGGG - Intronic
1049802643 8:144525299-144525321 GCTCCTGACCTGCTGGGCATGGG - Intronic
1050333598 9:4569851-4569873 CCCCAGGCCCTGCTGGGCATTGG + Intronic
1050457392 9:5847037-5847059 GCCTATGGGCTGCTGAGCATTGG - Intergenic
1051689999 9:19701387-19701409 GACTAAGTGCTGCTTGGCATGGG - Intronic
1055315327 9:75028478-75028500 GCTCATTTGCTGCCGGGCTTCGG + Intergenic
1057261298 9:93586324-93586346 TGCTATGTGCTGCTGGGCAGTGG - Intronic
1060449705 9:123725635-123725657 GCCCTCCTGCTGCTGGGCAGAGG - Intronic
1060786003 9:126452037-126452059 GCACAGGAGCTGCTGGGAATGGG - Intronic
1061326356 9:129867159-129867181 GCTCGGGTGGTGCTGGGCATTGG - Intronic
1061875248 9:133540291-133540313 ACCCCTGTGCTGCTGGCCCTGGG - Intronic
1062254911 9:135616344-135616366 GCCCAGGGGGTGCTGGGGATGGG - Intergenic
1062384806 9:136304991-136305013 GCCTATGTGGGGCTGGGCTTGGG - Intronic
1062573074 9:137194422-137194444 CCCCATTTGCTGCTGGACTTCGG - Intronic
1187526441 X:20059332-20059354 TCCCAGGTGCTGCTGGTCATGGG + Intronic
1192658952 X:73022070-73022092 GACCATGGGCGGCTGGGCAGAGG + Intergenic
1196126786 X:112109773-112109795 CCCCAACTGCTGCTGGGAATTGG + Intergenic
1196799150 X:119526591-119526613 GTCCACGTGGTGCTGGGCAGGGG - Intergenic
1200161190 X:154010550-154010572 GCCCCCGTGAAGCTGGGCATTGG - Exonic
1200833712 Y:7712377-7712399 AACCATGTTCTGCTGGGCTTTGG - Intergenic
1200834789 Y:7722773-7722795 GCCTATGTGCAGCTGGGCATGGG + Intergenic
1201648452 Y:16261014-16261036 GCCCAACTGCTGTTGGGAATTGG + Intergenic
1201654358 Y:16324287-16324309 GCCCAACTGCTGTTGGGAATTGG - Intergenic