ID: 1032689031

View in Genome Browser
Species Human (GRCh38)
Location 7:134264081-134264103
Sequence CAGGTAGAACATTCTTCCGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 70}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032689031_1032689036 16 Left 1032689031 7:134264081-134264103 CCCACGGAAGAATGTTCTACCTG 0: 1
1: 0
2: 1
3: 5
4: 70
Right 1032689036 7:134264120-134264142 CAGTTTCTCTTGTGATTCTTTGG 0: 1
1: 0
2: 1
3: 28
4: 293
1032689031_1032689037 20 Left 1032689031 7:134264081-134264103 CCCACGGAAGAATGTTCTACCTG 0: 1
1: 0
2: 1
3: 5
4: 70
Right 1032689037 7:134264124-134264146 TTCTCTTGTGATTCTTTGGCTGG 0: 1
1: 0
2: 2
3: 24
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032689031 Original CRISPR CAGGTAGAACATTCTTCCGT GGG (reversed) Exonic
902107427 1:14049511-14049533 AAGGTAGAAAATTGTTCAGTAGG - Intergenic
902650706 1:17835624-17835646 CTGGTAGAACTTTCTGTCGTGGG + Intergenic
906990938 1:50737450-50737472 CATGTAGAACATTATTTTGTAGG - Intronic
907526943 1:55059311-55059333 CTGGCAGAACAGTCTTCCTTGGG + Intronic
910039195 1:82827615-82827637 TACATAGAACATTCTTCCTTCGG - Intergenic
910624018 1:89286880-89286902 CAGATATCACATTCTTCCATTGG - Intergenic
912452096 1:109773496-109773518 CCATTAGAACATTCTTCCTTAGG + Intronic
913612697 1:120523874-120523896 CAGGTAGAACATTCTTCCCAGGG - Intergenic
914578495 1:148998373-148998395 CAGGTAGGACATTCTTCCCAGGG + Exonic
920707993 1:208268901-208268923 CAGGGAGAATATTCTTACGATGG - Intergenic
1066376353 10:34860841-34860863 CAGGTAGAAAGTTTTTCTGTTGG - Intergenic
1072573490 10:96678656-96678678 CAGGTAGAAAATTCCTTCCTTGG + Intronic
1073527386 10:104196980-104197002 GAGGTAGAACATGCTTCCATAGG - Intronic
1079752237 11:24213411-24213433 CAGTCAGAACCTTCTTCTGTAGG - Intergenic
1080940067 11:36906417-36906439 CAGACAGAACAGTCTTCTGTTGG + Intergenic
1084031402 11:66482833-66482855 CAGGCAGAACATTCTGCCCAGGG - Intronic
1085671550 11:78469451-78469473 CAGGCAGATCATTCTTTCATAGG - Intronic
1086538971 11:87884917-87884939 CAGGTAGAACATTTAACTGTGGG + Intergenic
1087065211 11:94021494-94021516 CAGTAATAACATTCTTCCCTTGG - Exonic
1087913826 11:103784665-103784687 CAGGCAAAGCATTCTTCCTTTGG + Intergenic
1093644052 12:21562860-21562882 TAGGGAGAACTTTCTTCTGTGGG - Intronic
1104405878 12:128516277-128516299 CCTGTGGAACATTCTTCCGATGG + Intronic
1106382410 13:29252980-29253002 TAGGGAGAACATTCTTCCAGTGG + Intronic
1107158930 13:37202744-37202766 CAAGTATAACAGTCTTCAGTTGG + Intergenic
1115460403 14:33653703-33653725 CAGGTAGCAAATACTTCCCTTGG + Intronic
1116445903 14:45011091-45011113 CAGATTTAACATTCTTCAGTTGG + Intronic
1122269243 14:100561006-100561028 CAGGCAGAAAATCCTTCCGAGGG - Intronic
1127704342 15:61532522-61532544 CAGGTAGGACATTCTTGATTAGG - Intergenic
1141838889 16:86561330-86561352 CAGGAAGATCAGTCTTCCCTGGG - Intergenic
1156324189 18:36058353-36058375 CAAGTAGAAGTTTCTTCTGTTGG - Intronic
1156630968 18:38967975-38967997 CATGAAGAACATTTTTCCTTGGG - Intergenic
1158874455 18:61719689-61719711 CAGTGAGAAAATTCTTCCTTGGG - Intergenic
1159098502 18:63933290-63933312 TAGGGAGAACATTCTTCCTGAGG - Intronic
1163133817 19:15294683-15294705 CATTTACAACATTCTTCCCTGGG - Intronic
1164723142 19:30446319-30446341 CAGGTGGTACATTTTTCAGTGGG + Intronic
933202144 2:79463545-79463567 CACCTAGAACATTCTTTCTTTGG + Intronic
941171806 2:162146983-162147005 CAAATATAACATTCTTTCGTGGG - Intronic
943308387 2:186296275-186296297 AGGGTAGAAAATTCTTCCATAGG + Intergenic
1171388261 20:24784967-24784989 TTGGTGGAACATTCTTCCCTGGG - Intergenic
1179355064 21:40651384-40651406 AAGTTAGCACATTCTTCCTTAGG + Intronic
1180145068 21:45914230-45914252 GAGGGAGAACATGATTCCGTGGG - Intronic
1183707569 22:39483846-39483868 CAGGTAGAACAATCTGGGGTAGG - Intronic
955040718 3:55315112-55315134 CAAGTAGAAAATTCTTACTTCGG - Intergenic
956150928 3:66241514-66241536 CAGGTTTTACATTCTTCCCTCGG + Intronic
959461932 3:106637660-106637682 CAGGAAGAACATACTTCATTAGG - Intergenic
964390521 3:156191958-156191980 CAGCTAGAACATCCTTTCTTTGG + Intronic
966260074 3:177966040-177966062 CAAGTAGAAAATTCTTCAGTTGG + Intergenic
966272216 3:178121057-178121079 CAGCTAGAACAGTCTTGCTTTGG + Intergenic
971087934 4:23300952-23300974 CAGGTAAAACATTTTACTGTGGG - Intergenic
978465963 4:109009227-109009249 AAGCTATAACTTTCTTCCGTGGG + Intronic
986277919 5:6296686-6296708 TTCGTAGAACATCCTTCCGTTGG - Intergenic
987851408 5:23360666-23360688 TAAGTAGACCATTCTTCCTTGGG + Intergenic
994802096 5:104391440-104391462 CAAGTAGAATATTCTGCCTTTGG - Intergenic
997242055 5:132314922-132314944 CAGGTAGCACACTCTTCAGCAGG + Intronic
1001420221 5:171580686-171580708 CAGGCAGAACATTCATCCGGAGG - Intergenic
1008705648 6:54155518-54155540 CTGTTAGATCATTCTTCCTTTGG + Intronic
1012805645 6:103889331-103889353 CAGGTAGAAATTTCTGCAGTTGG - Intergenic
1016400052 6:143670470-143670492 CAGGTAGACCATTCAAACGTAGG + Intronic
1017423810 6:154299962-154299984 CATGTATAACATTCATCAGTTGG + Intronic
1018652567 6:166004498-166004520 TAGGTAGAATATTGTTCTGTTGG - Intergenic
1019594497 7:1852146-1852168 CAGGAAGCACTTTCTTCCCTGGG - Intronic
1021622845 7:22565033-22565055 CTGGTCCAACATTCTTCCATCGG - Intronic
1024929233 7:54652557-54652579 GATGTTGAACATTCTTCCCTCGG + Intergenic
1027408409 7:77887255-77887277 CTGTTAGAACAGTCTTCAGTAGG + Intronic
1032689031 7:134264081-134264103 CAGGTAGAACATTCTTCCGTGGG - Exonic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1043526313 8:81100428-81100450 GAGGTAGAAAATTCTTCCCTGGG + Intronic
1044132413 8:88540888-88540910 CAGAGAGATCATTCTTCAGTGGG - Intergenic
1046092505 8:109520044-109520066 CAGGTGGAAGTTTCTTCCATTGG + Intronic
1053211094 9:36229091-36229113 CATGAAGAACATTCTCCCCTAGG + Exonic
1055261448 9:74439464-74439486 GAGGTGGAATATTGTTCCGTGGG + Intergenic
1060798645 9:126529483-126529505 CAGGAGAAACATTCTTCTGTGGG - Intergenic
1186206182 X:7203217-7203239 TACTTAGAACATTCTTCCATGGG + Intergenic
1189137946 X:38569269-38569291 CAATTAGAAGATTCTTCTGTAGG - Intronic
1194958408 X:100207928-100207950 CAGTTAAATCATTCTTCAGTGGG + Intergenic
1196749758 X:119105287-119105309 GAGGTAGGAAATTCTTCCCTGGG - Intronic
1199344730 X:146725213-146725235 CAGGTAGAATATTTTCCCTTTGG + Intergenic