ID: 1032693859

View in Genome Browser
Species Human (GRCh38)
Location 7:134316629-134316651
Sequence CCGCCCCGCCCCGGGAGACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 295}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032693851_1032693859 4 Left 1032693851 7:134316602-134316624 CCGGGGGGACCTCTCCTCTGGCT 0: 1
1: 0
2: 0
3: 26
4: 227
Right 1032693859 7:134316629-134316651 CCGCCCCGCCCCGGGAGACCGGG 0: 1
1: 0
2: 3
3: 36
4: 295
1032693850_1032693859 5 Left 1032693850 7:134316601-134316623 CCCGGGGGGACCTCTCCTCTGGC 0: 1
1: 0
2: 0
3: 22
4: 185
Right 1032693859 7:134316629-134316651 CCGCCCCGCCCCGGGAGACCGGG 0: 1
1: 0
2: 3
3: 36
4: 295
1032693853_1032693859 -10 Left 1032693853 7:134316616-134316638 CCTCTGGCTTCCTCCGCCCCGCC 0: 1
1: 1
2: 3
3: 35
4: 449
Right 1032693859 7:134316629-134316651 CCGCCCCGCCCCGGGAGACCGGG 0: 1
1: 0
2: 3
3: 36
4: 295
1032693852_1032693859 -5 Left 1032693852 7:134316611-134316633 CCTCTCCTCTGGCTTCCTCCGCC 0: 1
1: 0
2: 7
3: 79
4: 689
Right 1032693859 7:134316629-134316651 CCGCCCCGCCCCGGGAGACCGGG 0: 1
1: 0
2: 3
3: 36
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032693859 Original CRISPR CCGCCCCGCCCCGGGAGACC GGG Intronic
900104228 1:975466-975488 GAGCCCCTCCCCGGGAGCCCTGG - Exonic
900109736 1:1000391-1000413 CCGCCCAGCCCCGGGGGTCCCGG - Intergenic
900298664 1:1965642-1965664 CCCCCCCACCCCGGGAAGCCAGG - Intronic
900309777 1:2028098-2028120 CGGCCCTGCCCCGGGAGCCCTGG - Intronic
900375733 1:2353763-2353785 CCTCCCTGCCCCGGGACAGCAGG - Intronic
900394179 1:2446388-2446410 ACCCCCAGCCCCGGGAGACCTGG - Intronic
901002622 1:6156080-6156102 CCGACCAGCCTCGGGACACCAGG + Intronic
901234770 1:7661872-7661894 CCCGCCTGCCCCGGGAGCCCCGG - Intronic
902217871 1:14945829-14945851 CCGCTCCGGCCCGGAAGACTTGG + Intronic
902348260 1:15835113-15835135 CCGCCCCGCCCAGGGGCAACAGG + Intergenic
902480337 1:16708148-16708170 CCTCCCCTCCCGGGGAGCCCTGG + Intergenic
902920715 1:19664916-19664938 CCTCCCGGGCTCGGGAGACCCGG + Intergenic
903193459 1:21669098-21669120 ACCCCTCGCCCCTGGAGACCCGG + Intronic
903233870 1:21937346-21937368 CCGCCCCGCCCCCGCAGCGCCGG + Intergenic
903652497 1:24930310-24930332 CAGCCCCGCCCCGCGGGCCCCGG - Intronic
903792791 1:25906176-25906198 CAGCCGCGCCCCCGGAGAGCGGG + Intronic
903855751 1:26336810-26336832 CCGCCCCGCTCCCGGAGCCCGGG + Intronic
904239396 1:29134303-29134325 CTCCCCCGGCCCTGGAGACCGGG - Intergenic
905639212 1:39576892-39576914 CCGCCCCGCCTCGGGCCCCCGGG - Intergenic
905647193 1:39633013-39633035 CCGCCCCGCCCCCGGGGATCGGG - Intronic
905789958 1:40784451-40784473 CGGCCGTGCCCCGGGAGGCCAGG - Intronic
905862658 1:41361566-41361588 CGGCCTCGTCCCGGGAGAGCAGG + Intergenic
907179052 1:52553522-52553544 CCGCCCCTGCCCGCGAGCCCCGG - Intergenic
907444611 1:54499707-54499729 CCAACCCTCCCCGGGCGACCAGG - Intergenic
912787461 1:112618877-112618899 CCGCCCTGCCCCAGGAGGTCTGG + Intronic
915345522 1:155195129-155195151 CCGGCCCGACCCGGGAACCCGGG - Intergenic
915511336 1:156388537-156388559 CCGCGCCGCCCCGCGCGCCCCGG + Intergenic
919463241 1:197902936-197902958 CCGCCCCGCCGCGGCCGCCCCGG + Intronic
921089688 1:211830756-211830778 CCGCCCCTCCCCGCCAGTCCGGG - Exonic
923107910 1:230868567-230868589 TCGCCCCGCCCCGCGCCACCCGG + Exonic
923463867 1:234231430-234231452 CCGCCGGGCCCGGGGAGTCCCGG - Exonic
923684135 1:236142388-236142410 CCGCCCCGGCCCGCGCGCCCCGG - Intergenic
923913223 1:238472748-238472770 CAGCCCTGCCTTGGGAGACCAGG - Intergenic
924551689 1:245084060-245084082 CCGCCCCCCCCCCGGCGCCCCGG + Intronic
924577273 1:245291944-245291966 TCACCCAGCCCCAGGAGACCCGG - Intronic
1065367865 10:24952702-24952724 CCGCCCCGCCCCGGGCCCGCCGG + Intergenic
1066653540 10:37680581-37680603 CCGAGCCACACCGGGAGACCAGG - Intergenic
1068544108 10:58327173-58327195 CTGCCCCGCTCCGGGAGGCCAGG - Intergenic
1073098895 10:100997054-100997076 CCGCCCCGCCCCGCTCCACCAGG + Intronic
1073196456 10:101695190-101695212 CCGCGCCGCCCCATGTGACCCGG - Exonic
1074565250 10:114571782-114571804 AGGCCCTGCCCCAGGAGACCTGG + Intronic
1074865430 10:117542121-117542143 CGGCCCCGCGTCGGGAGAACTGG - Intergenic
1075129351 10:119725609-119725631 CCGCACCGCTCCGGGAGAGCGGG + Intergenic
1075129621 10:119726460-119726482 CCGCCCCGCCCCGCCTCACCAGG - Intronic
1075521844 10:123148091-123148113 CCTCCGCGCCGCCGGAGACCCGG + Intergenic
1076355914 10:129853068-129853090 CCACCCCTGCCCGGGAGAGCTGG + Intronic
1076904982 10:133357153-133357175 CCGCCCTGCCCTGGGGGACCTGG + Intronic
1076948697 10:133667397-133667419 CGGCCCTGGCCCGGGAGACGCGG + Exonic
1076949681 10:133670696-133670718 CGGCCCTGGCCCGGGAGACGCGG + Intronic
1076950665 10:133673995-133674017 CGGCCCTGGCCCGGGAGACGCGG + Intergenic
1076951655 10:133677305-133677327 CGGCCCTGGCCCGGGAGACGCGG + Intergenic
1076952645 10:133680615-133680637 CGGCCCTGGCCCGGGAGACGCGG + Intergenic
1076953628 10:133683914-133683936 CGGCCCTGGCCCGGGAGACGCGG + Intergenic
1076955601 10:133743576-133743598 CGGCCCTGGCCCGGGAGACGCGG + Intergenic
1076956591 10:133746886-133746908 CGGCCCTGGCCCGGGAGACGCGG + Intergenic
1076957579 10:133750195-133750217 CGGCCCTGGCCCGGGAGACGCGG + Intergenic
1076958563 10:133753494-133753516 CGGCCCTGGCCCGGGAGACGCGG + Intergenic
1076959552 10:133756804-133756826 CGGCCCTGGCCCGGGAGACGCGG + Intergenic
1076960536 10:133760103-133760125 CGGCCCTGGCCCGGGAGACGCGG + Intergenic
1076985973 11:236359-236381 TCGCCCCGCCCCCGGCGCCCCGG + Exonic
1077076923 11:706187-706209 CCACCCGCCCGCGGGAGACCTGG + Exonic
1077105951 11:842724-842746 CCGCGCGGGCCCGGGAGCCCCGG - Intergenic
1077116007 11:884934-884956 CCGCCTGGCCCAGGGAGAGCTGG + Intronic
1077144323 11:1037844-1037866 GAGCCCGGCCCAGGGAGACCAGG - Intergenic
1077419817 11:2444947-2444969 CGGCCCCGCCCCGAGCGCCCGGG + Intronic
1077886252 11:6390298-6390320 CCGCCCTGCCCCGGGCGCACGGG - Intergenic
1078540115 11:12206508-12206530 CCACCCTGCCAGGGGAGACCTGG - Intronic
1078987054 11:16607056-16607078 CCGCCCCGGCCCGGCAGCCGCGG + Intronic
1079238461 11:18706141-18706163 CCGCCCCGCCCGCGCAGTCCAGG - Exonic
1080642550 11:34166211-34166233 CCGCCCTTCCCCTGGATACCAGG + Intronic
1080802179 11:35618908-35618930 ACGGCCCGCCCCGGCAGTCCCGG + Exonic
1081578356 11:44334007-44334029 CCGCCCCGCCCCAGGGGCGCAGG - Intergenic
1081636882 11:44727325-44727347 CCGCCGCGCCCCCGGGGACCTGG + Intronic
1083664634 11:64267809-64267831 CCTCCCTTCCCCGGGAGAGCTGG + Intronic
1083747318 11:64743431-64743453 TCGCCCCCTCCCGGGAGCCCAGG + Intronic
1083992974 11:66258011-66258033 CGCCCCCGCCCCGGGCCACCCGG - Intronic
1084190056 11:67494699-67494721 CTGCCCCGCCCCTGGGGTCCTGG - Intronic
1084375339 11:68773115-68773137 CCACCCGGCCCCCGGAGACCGGG + Intronic
1084385736 11:68841746-68841768 CCTCCCCACCGCGGGCGACCGGG + Intronic
1084888117 11:72223827-72223849 CCGCGCCGCCCCGGGGAGCCGGG - Intronic
1084973038 11:72781717-72781739 CCGCAGCTGCCCGGGAGACCCGG + Intronic
1085396271 11:76208672-76208694 CCTCCTCTCCCTGGGAGACCAGG - Intronic
1089533858 11:119149220-119149242 CCGCCCCGGCCCGGGCCGCCGGG + Exonic
1089605616 11:119639730-119639752 CCTCCCCACCCTGGGGGACCAGG - Intronic
1089708345 11:120297280-120297302 CTGCCCTGCCCTGGGACACCTGG + Intronic
1096803603 12:54127193-54127215 CCGCCCCGTCCCGGCAGAGTCGG - Intergenic
1098342885 12:69470296-69470318 CCGCCCCGCCCTGGAGGCCCTGG + Intergenic
1098550334 12:71755014-71755036 CCGCCCCGGCCCCGCCGACCCGG - Exonic
1100611421 12:96194412-96194434 CCGCCCCGCGCCGCGCGCCCCGG - Exonic
1101761184 12:107660271-107660293 CCAGCCAGCCCTGGGAGACCTGG + Intergenic
1102679981 12:114684730-114684752 TCTCCCCGCCCCGGGCGAGCCGG + Intergenic
1103091790 12:118103388-118103410 TCGCCCCGCACCGGGCGCCCGGG + Intronic
1103433008 12:120904058-120904080 CCGCCCCGCCCCGGGGCCCAGGG - Exonic
1104602351 12:130162315-130162337 CCGCCCCGCCGCGGGCTCCCGGG - Intergenic
1105031481 12:132887401-132887423 CCGCCCCACCCCGCGGGCCCCGG + Intronic
1107898498 13:44989326-44989348 CTGCCCCGCCGCGGGACAGCTGG - Exonic
1107907248 13:45072557-45072579 CAGCCCTGCCCCGGGAAAACTGG + Intergenic
1114473738 14:22980757-22980779 CCGCCCCGCCCGCGGGCACCTGG + Intronic
1114519084 14:23321700-23321722 CCGCGCCCCCCCGGGAGCTCCGG + Exonic
1115203000 14:30874190-30874212 CCGCCCCACCCAGCGAGGCCTGG - Intergenic
1115610661 14:35046235-35046257 CCGCCCCGCCCCGCGCGAGCCGG + Intronic
1116905182 14:50396930-50396952 CGGCCCCGCCCAGGCAGACCCGG - Intronic
1117377407 14:55129179-55129201 CCGCCCCGCCTCGGGAGAGGCGG + Exonic
1117508931 14:56429420-56429442 CTGCCCCTCTCCTGGAGACCTGG + Intergenic
1119780031 14:77271200-77271222 CCGCCCCACCCCGCGACGCCTGG + Exonic
1120145325 14:80972777-80972799 CCTCCCAGCCCCTGGAAACCAGG + Intronic
1122264533 14:100540450-100540472 CCACCCCGCCCCGGGACCACCGG - Intronic
1122785842 14:104162923-104162945 CCGCCCCGCCCCAAGAAACCTGG + Intronic
1123118269 14:105904558-105904580 CCGCCCAGCCTGGGGAAACCCGG + Intergenic
1202856105 14_GL000225v1_random:53071-53093 CGGCCCTGGCCCGGGAGACACGG + Intergenic
1202868312 14_GL000225v1_random:136804-136826 CGGCCCTGGCCCGGGAGACACGG - Intergenic
1125516414 15:40323682-40323704 CCGCGCGGCCACTGGAGACCAGG + Intergenic
1128651213 15:69414760-69414782 CTGCCCCGCCCCCGGGAACCGGG - Intronic
1130019519 15:80216166-80216188 CCGCCCCAGCCCTGGAGAACGGG - Intergenic
1130295723 15:82646438-82646460 CCGCCCCGCGCCTGCAGCCCCGG - Intronic
1131177659 15:90220074-90220096 CCTCCCCGCACAGGGAGACATGG - Intronic
1131187488 15:90287307-90287329 CCTCCCCGCCCCCCGACACCGGG - Intronic
1131257467 15:90871779-90871801 CAGCCGGGCCCCGGGGGACCCGG - Intronic
1132056031 15:98650352-98650374 CCGCCCAGCCCCGGGACGCCGGG - Intronic
1132494424 16:254539-254561 CCGCTCGGCACCGGGAGAGCCGG - Exonic
1132843466 16:1989761-1989783 CCACCCTGCCCCCGGGGACCTGG + Intronic
1132885711 16:2181139-2181161 GCACCCCGCCCAGGGAGGCCCGG - Exonic
1132947210 16:2538198-2538220 CCGCCCCGCCTCGCCGGACCCGG - Intronic
1133032458 16:3017874-3017896 GCGCCCCGCCCCGAGAGGCAAGG + Intronic
1133212690 16:4272175-4272197 CCACCCCGCGCCGGGAGCCGCGG + Intronic
1134615799 16:15650368-15650390 CTGCCCCGCCCCAGGATCCCGGG + Intronic
1134849787 16:17470593-17470615 CGGCCCCGCGCCGGGAGCGCCGG - Exonic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1136460508 16:30407576-30407598 CCTCCCCGCCCCCGGAGCCGCGG + Exonic
1137426442 16:48384966-48384988 CGCCCCCGCCCCTGGAGCCCCGG - Intronic
1138265475 16:55656849-55656871 ACGCGCAGCCCCGGGAGACCTGG + Exonic
1138581000 16:57940320-57940342 CCACCCCGCCCCGGGTCACAGGG - Exonic
1139390777 16:66605297-66605319 CCGCTGCGGCCCGGGAGTCCCGG - Intronic
1141591655 16:85073292-85073314 CCTGCCCTCCCCGGGAGATCTGG + Intronic
1142136240 16:88453208-88453230 CCGCCCCGCCCCCGGCGCTCCGG - Intergenic
1142493490 17:293471-293493 CTGCCCCACCCCCGGAGCCCCGG - Intronic
1142501651 17:336480-336502 CCGCCCCGAGCAGGCAGACCTGG - Intronic
1143155428 17:4833453-4833475 CCGCGCCTCCCCCGGAGACCGGG - Exonic
1143174354 17:4947949-4947971 CCGCCCCGCCCTGGGAGAGGCGG + Intronic
1143183536 17:4998030-4998052 CCGCCCCTCGCCGGGTGCCCGGG - Exonic
1143830246 17:9645502-9645524 CCGCCCCGTCCCCGCACACCTGG + Intronic
1144953154 17:19004655-19004677 CGGCGACGCCCCGCGAGACCCGG + Intronic
1145034823 17:19533774-19533796 CCGCCCCGCGCCTGGCGCCCGGG - Intronic
1146788844 17:35740266-35740288 CCGACCATCCCCAGGAGACCAGG - Intronic
1147184493 17:38705889-38705911 CCGCCCGGTCCTGGAAGACCGGG + Intronic
1147586103 17:41654828-41654850 CTGCCCAGCCCCGTGAGGCCGGG + Intergenic
1147890578 17:43713940-43713962 CCTCCTGGCCCCTGGAGACCTGG - Intergenic
1147987597 17:44315369-44315391 CCGCCCCGCCCCGGGATGCCCGG - Intronic
1148218043 17:45844693-45844715 CCCCCCAACCCTGGGAGACCAGG - Intergenic
1150002670 17:61451671-61451693 CCGCCCCGCACCCGGCCACCGGG + Intergenic
1150267873 17:63842571-63842593 CCGCCTCCCCCCGCGGGACCCGG - Exonic
1151926415 17:77200857-77200879 CCGTCCCGCCCCGGGCAGCCAGG + Intronic
1152168043 17:78723636-78723658 CCCCTCCCCCCCGGGAGGCCGGG - Intronic
1152421991 17:80198528-80198550 CCGCCGAGCCCGGGGTGACCCGG - Exonic
1152821447 17:82439745-82439767 CGGCCCCTCCCCGAAAGACCCGG + Intronic
1152861207 17:82697983-82698005 GCGCTCCGCCCCAGGAGCCCCGG + Intronic
1155971931 18:32091794-32091816 CCGCCCCGCCTCGCTAGGCCCGG - Intergenic
1157565331 18:48675706-48675728 CCGCCCCTCCCTGGGACCCCTGG + Intronic
1160529113 18:79553304-79553326 CTGCCCCGTCCCGAGAAACCTGG + Intergenic
1160775517 19:853400-853422 CCGCCCCGCCCGGCGGCACCTGG - Exonic
1161101874 19:2425501-2425523 CCGCCCCGGCCCAGGGGACCAGG + Intronic
1161293439 19:3507534-3507556 CCGCCCCGCCCCAGTCTACCGGG + Intronic
1161339026 19:3730544-3730566 CCGGCCCGGCCCCGGCGACCAGG - Exonic
1161664669 19:5568062-5568084 CCGCCCCGCCCCGCCGGGCCGGG - Intergenic
1161977054 19:7612764-7612786 CAGCCCCGCCCGGCGAGTCCCGG + Exonic
1162959619 19:14118090-14118112 CCGCCCCGCCCCGCCGGCCCGGG - Intergenic
1163154512 19:15432577-15432599 CCGCCCAGCCCCCCGAGCCCGGG - Intronic
1163715628 19:18870548-18870570 CGGCCCCGCCCCCGTGGACCCGG - Exonic
1164539407 19:29111765-29111787 CAGCCCCGCCAAGGGAGGCCAGG - Intergenic
1164844479 19:31420172-31420194 CCGCCCCTTCCTGGCAGACCAGG + Intergenic
1165266039 19:34664432-34664454 CAGCCCTGCCCAGGGACACCAGG + Intronic
1165419983 19:35717882-35717904 CAGCGCCGCCGCGGGAGACCGGG - Intergenic
1166139591 19:40799083-40799105 CCGCCCCGCCCCGCGCGGCTCGG + Intronic
1166215327 19:41331015-41331037 CCGCCCCGCCCCGGCAGGCCCGG - Exonic
1166329646 19:42070435-42070457 CCGCCCTGCCCAGGCAGCCCTGG + Exonic
1166802947 19:45469306-45469328 CCGCCCCGCCCCTGACGTCCCGG + Intronic
1167321629 19:48800155-48800177 CCTCCCCACCCCGGTGGACCGGG + Intronic
1167587434 19:50382913-50382935 CCCCCCTAGCCCGGGAGACCAGG + Exonic
1168230291 19:55027018-55027040 CGGCCCCGCCCCTGCAGCCCAGG + Intronic
1168230311 19:55027072-55027094 CGGCCCCGCCCCTGCAGCCCAGG + Intronic
1168230331 19:55027126-55027148 CGGCCCCGCCCCTGCAGCCCAGG + Intronic
1168230351 19:55027180-55027202 CGGCCCCGCCCCTGCAGCCCAGG + Intronic
1168230371 19:55027234-55027256 CGGCCCCGCCCCTGCAGCCCAGG + Intronic
1168230426 19:55027396-55027418 CGGCCCCGCCCCTGCAGCCCAGG + Intronic
1168230446 19:55027450-55027472 CGGCCCCGCCCCTGCAGCCCAGG + Intronic
1168543337 19:57230907-57230929 CCGCCCCAACCCGGGAACCCTGG + Intronic
1202714376 1_KI270714v1_random:34050-34072 CCTCCCCTCCCGGGGAGCCCTGG + Intergenic
927945855 2:27134717-27134739 AAGCCCCGCCCCGGGAAACGCGG - Intergenic
930156435 2:48111778-48111800 CAGCCCCACCCCTGGAGCCCTGG + Intergenic
930730412 2:54723607-54723629 TGGCCCCGCCCCCGGAGCCCCGG + Intronic
931277443 2:60756210-60756232 CAGCCCCGCCCCTGGAGGTCTGG - Exonic
932198448 2:69804578-69804600 CCGCCCAGCGCCAGGAGATCAGG + Exonic
934521996 2:95025596-95025618 GCCCCACGCCCCGGGAGACCCGG - Intergenic
939629451 2:144516079-144516101 CGGCCCCGCGCCGGGTGATCGGG + Intronic
946404091 2:219483616-219483638 CCGCCTGGCCCGGGGAGGCCTGG + Exonic
948596877 2:239085178-239085200 CCGCCACGCCCCAGGAGACATGG + Intronic
1169558145 20:6770168-6770190 CCGCGCCGCCCAGGAGGACCTGG - Exonic
1170150299 20:13221071-13221093 CCGCCCCGCACTCGGAGTCCCGG - Intergenic
1171328695 20:24318579-24318601 ACCCCCCGCCCCCGGAAACCCGG + Intergenic
1171452736 20:25247720-25247742 CCGCCCTGCACCGGGTCACCAGG - Intergenic
1172703039 20:36864009-36864031 CGGCCTCGGCCCGGGAGTCCCGG - Intergenic
1172944093 20:38674558-38674580 CCACCCCGCCCCCAGAGCCCCGG + Intergenic
1174607038 20:51768459-51768481 CCGCGCCGCCCCGGGGGAGGAGG + Exonic
1175215806 20:57391305-57391327 CCGCCCCGCCCCGGGCGCGCGGG - Intergenic
1176068978 20:63216271-63216293 CCGCCCCGCCGCACGAGACTGGG - Intergenic
1178922482 21:36747774-36747796 GCGCCCCGTCCCGGGCGGCCTGG - Exonic
1179209654 21:39313983-39314005 CCGCCGCCCCCCGTGGGACCTGG + Intronic
1179730040 21:43362550-43362572 CAGCCGCGCTCCGGGAGCCCTGG + Intergenic
1180007746 21:45031000-45031022 CCCCCCCGCCCCTGGAACCCAGG - Intergenic
1180225264 21:46388372-46388394 CCGCCCCTCCCCTGGAGCACAGG - Intronic
1181563188 22:23717432-23717454 CCGCCCCGCCCCTCCAGGCCTGG - Intergenic
1182427845 22:30284283-30284305 CCGCCCTGCTCCTGGGGACCAGG - Intergenic
1182532297 22:30969617-30969639 CCGCCCCGCTCCGGGGGAGGCGG + Intergenic
1183201476 22:36388006-36388028 CCGCCCCGCCCTCGGAGCCGCGG + Exonic
1183423726 22:37726320-37726342 CAGCGCCTCCCGGGGAGACCAGG + Exonic
1183531009 22:38353347-38353369 CAGCCCCGCCCCGCGTGACCAGG - Intronic
1184022951 22:41833219-41833241 CCGTCCCGCTCAGGGAGACGCGG - Exonic
1184095594 22:42314629-42314651 CCGCCTCTCCCAGGGAGAACAGG + Intronic
1184860896 22:47172875-47172897 CAGGCCCACCCCGGGAGCCCAGG - Intronic
1185268672 22:49918494-49918516 ACGCCCCGCCCCCGGACTCCTGG + Intronic
950730088 3:14948580-14948602 CGGCCCCGCCCCCGCCGACCCGG - Intronic
952451792 3:33440156-33440178 CCGCCCCGCCCGGGGCCCCCCGG + Exonic
954138978 3:48595330-48595352 CCGCTCCGCCCCCCGAGATCAGG - Intergenic
954372593 3:50176589-50176611 TGGCCCTGCCCTGGGAGACCTGG + Intronic
954406950 3:50350546-50350568 CCGCCCAGTCCCGCGAGCCCGGG + Intronic
954615641 3:51967603-51967625 CCGCCCCGCCCCGCGCGCCGCGG + Intronic
954646984 3:52137620-52137642 CCAGCCCACCCAGGGAGACCAGG + Intronic
956406335 3:68932326-68932348 CCGCCTCCCCGCGGGAGCCCCGG + Exonic
957084753 3:75669177-75669199 CGGCCCTGGCCCGGGAGACGCGG + Intergenic
965590365 3:170356816-170356838 CCGCCCCGCCCCGGCGGCCCCGG - Intergenic
966684835 3:182682738-182682760 GCGCGCCGGCCCGGGAGCCCGGG + Intergenic
966696337 3:182793720-182793742 CCCCCGCGCCCCGCGGGACCCGG + Exonic
967612434 3:191523486-191523508 CCATCCTGCCCCAGGAGACCAGG + Intergenic
968488221 4:875388-875410 ACGGCCTGCACCGGGAGACCGGG - Intronic
969214530 4:5711377-5711399 CCGCCCCGCCGCGGGCCATCCGG - Exonic
969532926 4:7739743-7739765 CAGCCCCCACCCGGGACACCCGG + Intronic
973931035 4:55793560-55793582 CAGCCCCACCGCGGGAGACGGGG + Intergenic
973954504 4:56049390-56049412 CCGCAGCGCCCCGGGACTCCAGG + Intergenic
973996829 4:56467300-56467322 CGGCCCCGCACCGTGGGACCAGG + Exonic
976092424 4:81471974-81471996 CCGCCCCGCCCCGGCAGGCGCGG + Intronic
978384473 4:108166945-108166967 CCGCACCGCCCCCGCAGCCCGGG + Intronic
981093326 4:140755805-140755827 TCGCCCAGCCCCAGGGGACCGGG + Intronic
982358266 4:154491877-154491899 CCGCCCCGCCCCCGGAGCAGCGG - Intergenic
985055586 4:186033025-186033047 CCGCCCCTCCATGGGAGGCCGGG - Intergenic
985446221 4:190022397-190022419 CGGCCCTGGCCCGGGAGACGCGG - Intergenic
985452151 4:190068181-190068203 CGGCCCTGGCCCGGGAGACGCGG + Intergenic
985453135 4:190071478-190071500 CGGCCCTGGCCCGGGAGACGCGG + Exonic
985454125 4:190074771-190074793 CGGCCCTGGCCCGGGAGACGCGG + Exonic
985455113 4:190078064-190078086 CGGCCCTGGCCCGGGAGACGCGG + Exonic
985456101 4:190081364-190081386 CGGCCCTGGCCCGGGAGACGCGG + Exonic
985457085 4:190084658-190084680 CGGCCCTGGCCCGGGAGACGCGG + Intergenic
985458072 4:190087951-190087973 CGGCCCTGGCCCGGGAGACGCGG + Exonic
985459061 4:190091251-190091273 CGGCCCTGGCCCGGGAGACGCGG + Exonic
985463314 4:190174020-190174042 CGGCCCTGGCCCGGGAGACGCGG + Exonic
987263135 5:16223395-16223417 CCTTCCCTCACCGGGAGACCTGG + Intergenic
988780948 5:34521480-34521502 CCCTCCCGCCCCGAGAGCCCAGG + Intergenic
990553694 5:56909564-56909586 CCGCCCCGGCCCGGGAGGAGAGG - Exonic
992716065 5:79513210-79513232 TCGCTCCACCCCCGGAGACCTGG - Exonic
994072771 5:95620614-95620636 CCGCGCGGCCACGGGGGACCTGG + Exonic
994175117 5:96702719-96702741 CGGCCCCGCCCCGGGAGCCCGGG - Intronic
997526494 5:134556201-134556223 CCTCCCCGCCCTGGCAGAGCTGG + Intronic
997976655 5:138445196-138445218 CCACCACGCACCGGGAGAGCCGG - Intronic
998797549 5:145835605-145835627 ACGCCCCGCCCCAGGAAACCTGG + Intergenic
1002439600 5:179257452-179257474 CCGCCCAGCCCGGGGAGTCCAGG + Intronic
1002645262 5:180649614-180649636 CCGCCCCGCCCCAGGCCAGCCGG - Exonic
1002926230 6:1607100-1607122 CCGCCCCTCCCCAGCAGGCCGGG - Intergenic
1003084961 6:3053693-3053715 CGGCTCCGCCCTGGGGGACCAGG + Intergenic
1004140568 6:13013858-13013880 GCGCCCGGCCCCGGGCGCCCGGG + Intronic
1005952749 6:30643572-30643594 TCTCCCTGCCCTGGGAGACCTGG + Intronic
1006224166 6:32522244-32522266 GCACCCCGCCCAGGGAGCCCCGG - Intronic
1006302279 6:33200074-33200096 CCGCCCCGCCCCGGGGGGGAGGG + Intronic
1006929835 6:37680997-37681019 CCCCCCCCCCCCAGGAAACCTGG + Intronic
1007701769 6:43770112-43770134 CCGGCCCGCCCCGGGGGGCGGGG - Intergenic
1007942419 6:45794470-45794492 CCGCCCTGCCCCAAGAAACCGGG + Intergenic
1009622440 6:66094799-66094821 CTGCCCCGCCGCGGGACAGCTGG - Intergenic
1009853733 6:69232639-69232661 CCACCCCTCCCCTGGATACCAGG + Intronic
1012401413 6:98845242-98845264 CCGCCCCGCCCCGCGGGCCCCGG + Intergenic
1013391645 6:109691373-109691395 CCGGACCGCCCCAGGAGACTCGG - Exonic
1015904983 6:138107538-138107560 CCGCCCCGGCCCGGCAGGGCAGG - Intergenic
1017011955 6:150069181-150069203 CCGTCCCGCCCCGGGATCCAGGG + Intergenic
1017717268 6:157221909-157221931 CCCCCCAGCCCTGGGAGCCCGGG + Intergenic
1018331009 6:162727579-162727601 ACGCCCCGCCTCGGCCGACCAGG - Intronic
1019291073 7:250594-250616 CCTCCCCACCCTGGGAGTCCAGG + Intronic
1019428599 7:988455-988477 CCGTCCCACCCCTGGAGCCCTGG - Intronic
1020445351 7:8262068-8262090 CCGCCCCGACCCCGGAGGGCAGG + Intronic
1021633033 7:22665267-22665289 CCCCCCACCCCCGGGAAACCTGG + Intergenic
1021998558 7:26202366-26202388 CCGCCCCCACCCGGGAGCGCGGG - Intronic
1022989629 7:35694934-35694956 CCGCGCCTCCTCGCGAGACCCGG - Exonic
1023221130 7:37920960-37920982 CCGCACCGTCCCGGGCGCCCTGG + Exonic
1023969022 7:44978166-44978188 CTGCCCCTCCCTGGGAGTCCTGG + Intronic
1024216704 7:47254560-47254582 CCGCCCCGCCCGGCGAGCCCGGG + Intergenic
1024586223 7:50844270-50844292 CCTCCCCAGCCTGGGAGACCAGG + Intergenic
1025207520 7:57002201-57002223 CCGCCCCTGCCCTGGGGACCGGG - Intergenic
1028657894 7:93231991-93232013 CCACCCCGCCCCTCTAGACCAGG + Intergenic
1028989538 7:97034620-97034642 CCCCCCCGCCCCGGGACCCTGGG + Intergenic
1029270841 7:99375507-99375529 CCGCCCCGCCCTAGGCGGCCTGG - Intronic
1029544342 7:101202387-101202409 CCTCCCCGGCCCGGCAGCCCTGG + Intergenic
1032693859 7:134316629-134316651 CCGCCCCGCCCCGGGAGACCGGG + Intronic
1034307898 7:150060719-150060741 CCGTCCAGCCCCGGGAGCCCGGG + Intergenic
1034418957 7:150979130-150979152 CCGCCCTCCCCCGGCAGCCCGGG + Intergenic
1034466430 7:151232634-151232656 CCGCCCCCTCCCGGGACGCCGGG + Exonic
1034798955 7:154039950-154039972 CCGTCCAGCCCCGGGAGCCCGGG - Intronic
1035292823 7:157850464-157850486 ACACCAGGCCCCGGGAGACCTGG - Intronic
1036999911 8:13705672-13705694 CCGCCAGGCCCAGGGAAACCTGG - Intergenic
1037828882 8:22176871-22176893 CCGCCCCGCCCCCGGCAGCCTGG + Intronic
1037903752 8:22703439-22703461 CCGACCCACCCTGGGAAACCCGG - Intergenic
1038311684 8:26449965-26449987 CCGCCCCGCCCCTGGGCGCCGGG - Intronic
1038883580 8:31640003-31640025 CCGCGCCGCTCCGGGCGTCCCGG + Intronic
1039875184 8:41578591-41578613 CCCTCCCGCCCCGGGAGTCCGGG + Intronic
1046080236 8:109362466-109362488 CCGCTTCGTCCCGGGAGAGCTGG - Exonic
1046770513 8:118112208-118112230 CCGCGCGGCCCCGGGCGCCCTGG + Intergenic
1048274506 8:133056065-133056087 CTGCCCTGCCCAGGGAGACCTGG - Intronic
1049245023 8:141557795-141557817 CAGCCCCTCCCCGGCAGGCCTGG - Intergenic
1049659016 8:143811457-143811479 CCTCACAGCCCCTGGAGACCGGG + Intronic
1051235329 9:14993187-14993209 ATGCCCCGCCCCCTGAGACCTGG - Intergenic
1056992344 9:91423722-91423744 CCGCCGCGGCCCCGGAGGCCCGG - Exonic
1057139103 9:92716119-92716141 CCTCACCGCCCTGGGAGCCCTGG - Intronic
1057773282 9:97984832-97984854 CCGCCCCGCGCCGGGCGCGCGGG + Intronic
1061680948 9:132242154-132242176 CGGCCCCGCCCCGGGACCCCGGG - Exonic
1061801431 9:133115283-133115305 CGGCCCCTCCCAAGGAGACCTGG + Intronic
1061828427 9:133275512-133275534 TCGCCCCCGCCCGGGAGACAGGG - Intergenic
1062274843 9:135725885-135725907 CCCACCCGCCCTGGGAGCCCAGG + Intronic
1062467331 9:136687055-136687077 CCGCCCCGCTCCGGGGCTCCGGG - Intronic
1185471540 X:386732-386754 CCGCCCCGCCCCGGGGGCTTCGG + Intronic
1187281338 X:17860651-17860673 CTGCCCCGGCCCGGAAAACCCGG - Intronic
1192274478 X:69615940-69615962 CCGCCCCGCGGCTGGAGGCCCGG + Intergenic
1192544839 X:72004721-72004743 CCGCTCCGGCCCAGGAGAGCTGG + Intergenic
1192584276 X:72307319-72307341 CAGCCCCACCCCGGGAGCCTTGG - Intergenic
1197692978 X:129522932-129522954 CCCCCAGGCCCCGGGAGAGCGGG + Intronic
1199772578 X:150983990-150984012 CCGCGCCCCCCCGGGCCACCGGG - Intronic
1199772705 X:150984311-150984333 CCGCCCCGCCCGGGCCGCCCGGG - Intronic
1200051357 X:153433492-153433514 CCTCTCCGCCCCAGGGGACCTGG + Intergenic
1200100904 X:153688717-153688739 CCGTGCCGCCGCGCGAGACCTGG + Exonic
1200107942 X:153724894-153724916 GCGCCCCTCCCCGGGGCACCAGG - Exonic
1200110989 X:153740819-153740841 CTGCCCCGCCCCGTGGCACCTGG - Intronic