ID: 1032696101

View in Genome Browser
Species Human (GRCh38)
Location 7:134337707-134337729
Sequence TGAGTACCTAATTACCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032696097_1032696101 4 Left 1032696097 7:134337680-134337702 CCCCACCTGGAAGGCTGTGCTCA No data
Right 1032696101 7:134337707-134337729 TGAGTACCTAATTACCAGCCAGG No data
1032696099_1032696101 2 Left 1032696099 7:134337682-134337704 CCACCTGGAAGGCTGTGCTCAGC No data
Right 1032696101 7:134337707-134337729 TGAGTACCTAATTACCAGCCAGG No data
1032696100_1032696101 -1 Left 1032696100 7:134337685-134337707 CCTGGAAGGCTGTGCTCAGCTCT No data
Right 1032696101 7:134337707-134337729 TGAGTACCTAATTACCAGCCAGG No data
1032696098_1032696101 3 Left 1032696098 7:134337681-134337703 CCCACCTGGAAGGCTGTGCTCAG No data
Right 1032696101 7:134337707-134337729 TGAGTACCTAATTACCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032696101 Original CRISPR TGAGTACCTAATTACCAGCC AGG Intergenic
No off target data available for this crispr