ID: 1032696320

View in Genome Browser
Species Human (GRCh38)
Location 7:134339696-134339718
Sequence CAGCCCAAGGTTACACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032696315_1032696320 11 Left 1032696315 7:134339662-134339684 CCTTGCCTACACAGATCAATAAC No data
Right 1032696320 7:134339696-134339718 CAGCCCAAGGTTACACAAGCAGG No data
1032696317_1032696320 6 Left 1032696317 7:134339667-134339689 CCTACACAGATCAATAACAAGGC No data
Right 1032696320 7:134339696-134339718 CAGCCCAAGGTTACACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032696320 Original CRISPR CAGCCCAAGGTTACACAAGC AGG Intergenic
No off target data available for this crispr