ID: 1032699095

View in Genome Browser
Species Human (GRCh38)
Location 7:134363163-134363185
Sequence TTGAATAAGCAGCATGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032699095_1032699104 30 Left 1032699095 7:134363163-134363185 CCCTTCTCATGCTGCTTATTCAA No data
Right 1032699104 7:134363216-134363238 AGAATAGGCTAAGTGCTGCCGGG No data
1032699095_1032699103 29 Left 1032699095 7:134363163-134363185 CCCTTCTCATGCTGCTTATTCAA No data
Right 1032699103 7:134363215-134363237 TAGAATAGGCTAAGTGCTGCCGG No data
1032699095_1032699099 4 Left 1032699095 7:134363163-134363185 CCCTTCTCATGCTGCTTATTCAA No data
Right 1032699099 7:134363190-134363212 GGGAATTAGTTATTGATCTGAGG No data
1032699095_1032699101 6 Left 1032699095 7:134363163-134363185 CCCTTCTCATGCTGCTTATTCAA No data
Right 1032699101 7:134363192-134363214 GAATTAGTTATTGATCTGAGGGG No data
1032699095_1032699102 15 Left 1032699095 7:134363163-134363185 CCCTTCTCATGCTGCTTATTCAA No data
Right 1032699102 7:134363201-134363223 ATTGATCTGAGGGGTAGAATAGG No data
1032699095_1032699100 5 Left 1032699095 7:134363163-134363185 CCCTTCTCATGCTGCTTATTCAA No data
Right 1032699100 7:134363191-134363213 GGAATTAGTTATTGATCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032699095 Original CRISPR TTGAATAAGCAGCATGAGAA GGG (reversed) Intergenic
No off target data available for this crispr