ID: 1032702407

View in Genome Browser
Species Human (GRCh38)
Location 7:134394042-134394064
Sequence AAGAGGGGCCTCTCCAGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032702394_1032702407 28 Left 1032702394 7:134393991-134394013 CCCCAACCACCATTTCCTCTGAC No data
Right 1032702407 7:134394042-134394064 AAGAGGGGCCTCTCCAGGATTGG No data
1032702395_1032702407 27 Left 1032702395 7:134393992-134394014 CCCAACCACCATTTCCTCTGACA No data
Right 1032702407 7:134394042-134394064 AAGAGGGGCCTCTCCAGGATTGG No data
1032702396_1032702407 26 Left 1032702396 7:134393993-134394015 CCAACCACCATTTCCTCTGACAT No data
Right 1032702407 7:134394042-134394064 AAGAGGGGCCTCTCCAGGATTGG No data
1032702399_1032702407 13 Left 1032702399 7:134394006-134394028 CCTCTGACATTTGAAATATCATT No data
Right 1032702407 7:134394042-134394064 AAGAGGGGCCTCTCCAGGATTGG No data
1032702403_1032702407 -10 Left 1032702403 7:134394029-134394051 CCCTTCCTCTTTAAAGAGGGGCC No data
Right 1032702407 7:134394042-134394064 AAGAGGGGCCTCTCCAGGATTGG No data
1032702397_1032702407 22 Left 1032702397 7:134393997-134394019 CCACCATTTCCTCTGACATTTGA No data
Right 1032702407 7:134394042-134394064 AAGAGGGGCCTCTCCAGGATTGG No data
1032702398_1032702407 19 Left 1032702398 7:134394000-134394022 CCATTTCCTCTGACATTTGAAAT No data
Right 1032702407 7:134394042-134394064 AAGAGGGGCCTCTCCAGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032702407 Original CRISPR AAGAGGGGCCTCTCCAGGAT TGG Intergenic