ID: 1032702692

View in Genome Browser
Species Human (GRCh38)
Location 7:134396507-134396529
Sequence AAGAGGGGCCTCTCCAGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032702684_1032702692 6 Left 1032702684 7:134396478-134396500 CCTGTGCAATATCATTCCTTCCC No data
Right 1032702692 7:134396507-134396529 AAGAGGGGCCTCTCCAGGATTGG No data
1032702683_1032702692 13 Left 1032702683 7:134396471-134396493 CCTCTGACCTGTGCAATATCATT No data
Right 1032702692 7:134396507-134396529 AAGAGGGGCCTCTCCAGGATTGG No data
1032702682_1032702692 19 Left 1032702682 7:134396465-134396487 CCGCTTCCTCTGACCTGTGCAAT No data
Right 1032702692 7:134396507-134396529 AAGAGGGGCCTCTCCAGGATTGG No data
1032702680_1032702692 28 Left 1032702680 7:134396456-134396478 CCTCAACTCCCGCTTCCTCTGAC No data
Right 1032702692 7:134396507-134396529 AAGAGGGGCCTCTCCAGGATTGG No data
1032702681_1032702692 20 Left 1032702681 7:134396464-134396486 CCCGCTTCCTCTGACCTGTGCAA No data
Right 1032702692 7:134396507-134396529 AAGAGGGGCCTCTCCAGGATTGG No data
1032702688_1032702692 -10 Left 1032702688 7:134396494-134396516 CCTTCCCTCTTTAAAGAGGGGCC No data
Right 1032702692 7:134396507-134396529 AAGAGGGGCCTCTCCAGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032702692 Original CRISPR AAGAGGGGCCTCTCCAGGAT TGG Intergenic