ID: 1032705044

View in Genome Browser
Species Human (GRCh38)
Location 7:134414274-134414296
Sequence GGGATGCTTTGAAGTCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032705044_1032705053 7 Left 1032705044 7:134414274-134414296 CCATCTGGACTTCAAAGCATCCC No data
Right 1032705053 7:134414304-134414326 GTGTCTGGGGAATAGACCATGGG No data
1032705044_1032705049 -6 Left 1032705044 7:134414274-134414296 CCATCTGGACTTCAAAGCATCCC No data
Right 1032705049 7:134414291-134414313 CATCCCTCTGGTGGTGTCTGGGG No data
1032705044_1032705048 -7 Left 1032705044 7:134414274-134414296 CCATCTGGACTTCAAAGCATCCC No data
Right 1032705048 7:134414290-134414312 GCATCCCTCTGGTGGTGTCTGGG No data
1032705044_1032705052 6 Left 1032705044 7:134414274-134414296 CCATCTGGACTTCAAAGCATCCC No data
Right 1032705052 7:134414303-134414325 GGTGTCTGGGGAATAGACCATGG No data
1032705044_1032705047 -8 Left 1032705044 7:134414274-134414296 CCATCTGGACTTCAAAGCATCCC No data
Right 1032705047 7:134414289-134414311 AGCATCCCTCTGGTGGTGTCTGG No data
1032705044_1032705057 23 Left 1032705044 7:134414274-134414296 CCATCTGGACTTCAAAGCATCCC No data
Right 1032705057 7:134414320-134414342 CCATGGGCGGGAAGAACAGCTGG No data
1032705044_1032705055 11 Left 1032705044 7:134414274-134414296 CCATCTGGACTTCAAAGCATCCC No data
Right 1032705055 7:134414308-134414330 CTGGGGAATAGACCATGGGCGGG No data
1032705044_1032705054 10 Left 1032705044 7:134414274-134414296 CCATCTGGACTTCAAAGCATCCC No data
Right 1032705054 7:134414307-134414329 TCTGGGGAATAGACCATGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032705044 Original CRISPR GGGATGCTTTGAAGTCCAGA TGG (reversed) Intergenic
No off target data available for this crispr