ID: 1032706170

View in Genome Browser
Species Human (GRCh38)
Location 7:134422794-134422816
Sequence TTCAGACAAGTGGCTGCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032706159_1032706170 16 Left 1032706159 7:134422755-134422777 CCTGGGACTCCCTTTCTGTCTAG No data
Right 1032706170 7:134422794-134422816 TTCAGACAAGTGGCTGCCGGGGG No data
1032706161_1032706170 6 Left 1032706161 7:134422765-134422787 CCTTTCTGTCTAGCCCAGCTCCT No data
Right 1032706170 7:134422794-134422816 TTCAGACAAGTGGCTGCCGGGGG No data
1032706157_1032706170 24 Left 1032706157 7:134422747-134422769 CCAGCCTGCCTGGGACTCCCTTT No data
Right 1032706170 7:134422794-134422816 TTCAGACAAGTGGCTGCCGGGGG No data
1032706160_1032706170 7 Left 1032706160 7:134422764-134422786 CCCTTTCTGTCTAGCCCAGCTCC No data
Right 1032706170 7:134422794-134422816 TTCAGACAAGTGGCTGCCGGGGG No data
1032706163_1032706170 -8 Left 1032706163 7:134422779-134422801 CCAGCTCCTTGTTCCTTCAGACA No data
Right 1032706170 7:134422794-134422816 TTCAGACAAGTGGCTGCCGGGGG No data
1032706158_1032706170 20 Left 1032706158 7:134422751-134422773 CCTGCCTGGGACTCCCTTTCTGT No data
Right 1032706170 7:134422794-134422816 TTCAGACAAGTGGCTGCCGGGGG No data
1032706162_1032706170 -7 Left 1032706162 7:134422778-134422800 CCCAGCTCCTTGTTCCTTCAGAC No data
Right 1032706170 7:134422794-134422816 TTCAGACAAGTGGCTGCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032706170 Original CRISPR TTCAGACAAGTGGCTGCCGG GGG Intergenic