ID: 1032706953

View in Genome Browser
Species Human (GRCh38)
Location 7:134428816-134428838
Sequence CACTTGTAAGTGAGGGCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032706948_1032706953 28 Left 1032706948 7:134428765-134428787 CCAATGTCTATCACTCCATTCTG No data
Right 1032706953 7:134428816-134428838 CACTTGTAAGTGAGGGCATGTGG No data
1032706950_1032706953 2 Left 1032706950 7:134428791-134428813 CCACGTGTATACATTACTTAGCT No data
Right 1032706953 7:134428816-134428838 CACTTGTAAGTGAGGGCATGTGG No data
1032706949_1032706953 13 Left 1032706949 7:134428780-134428802 CCATTCTGTGTCCACGTGTATAC No data
Right 1032706953 7:134428816-134428838 CACTTGTAAGTGAGGGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032706953 Original CRISPR CACTTGTAAGTGAGGGCATG TGG Intergenic
No off target data available for this crispr