ID: 1032714942

View in Genome Browser
Species Human (GRCh38)
Location 7:134500036-134500058
Sequence CACTTGAATCAAGGAGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178505
Summary {0: 3, 1: 491, 2: 10053, 3: 50717, 4: 117241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032714935_1032714942 17 Left 1032714935 7:134499996-134500018 CCTGTAATCCTAGCTACTCGGGA 0: 1741
1: 53151
2: 219857
3: 260311
4: 206836
Right 1032714942 7:134500036-134500058 CACTTGAATCAAGGAGGCGGAGG 0: 3
1: 491
2: 10053
3: 50717
4: 117241
1032714936_1032714942 9 Left 1032714936 7:134500004-134500026 CCTAGCTACTCGGGAGACTGAGG 0: 3228
1: 113305
2: 296144
3: 221452
4: 120028
Right 1032714942 7:134500036-134500058 CACTTGAATCAAGGAGGCGGAGG 0: 3
1: 491
2: 10053
3: 50717
4: 117241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032714942 Original CRISPR CACTTGAATCAAGGAGGCGG AGG Intergenic
Too many off-targets to display for this crispr