ID: 1032716507

View in Genome Browser
Species Human (GRCh38)
Location 7:134513406-134513428
Sequence CAAAATCAAGCCTGGGGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032716507_1032716519 23 Left 1032716507 7:134513406-134513428 CCGCGGCCCCAGGCTTGATTTTG No data
Right 1032716519 7:134513452-134513474 GAAATTGTCAAGGCAGTTCCAGG No data
1032716507_1032716520 28 Left 1032716507 7:134513406-134513428 CCGCGGCCCCAGGCTTGATTTTG No data
Right 1032716520 7:134513457-134513479 TGTCAAGGCAGTTCCAGGCCAGG No data
1032716507_1032716517 13 Left 1032716507 7:134513406-134513428 CCGCGGCCCCAGGCTTGATTTTG No data
Right 1032716517 7:134513442-134513464 GATCACACCTGAAATTGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032716507 Original CRISPR CAAAATCAAGCCTGGGGCCG CGG (reversed) Intergenic
No off target data available for this crispr