ID: 1032718022

View in Genome Browser
Species Human (GRCh38)
Location 7:134527567-134527589
Sequence CTTCTTAAGCAGCCTGTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 1, 2: 1, 3: 13, 4: 164}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032718018_1032718022 -2 Left 1032718018 7:134527546-134527568 CCCACTGTAGATAGCAGCAGCCT 0: 1
1: 0
2: 2
3: 8
4: 97
Right 1032718022 7:134527567-134527589 CTTCTTAAGCAGCCTGTGGCCGG 0: 1
1: 1
2: 1
3: 13
4: 164
1032718019_1032718022 -3 Left 1032718019 7:134527547-134527569 CCACTGTAGATAGCAGCAGCCTT 0: 1
1: 0
2: 0
3: 12
4: 193
Right 1032718022 7:134527567-134527589 CTTCTTAAGCAGCCTGTGGCCGG 0: 1
1: 1
2: 1
3: 13
4: 164
1032718015_1032718022 14 Left 1032718015 7:134527530-134527552 CCAGGCTCCAACTCCTCCCACTG 0: 1
1: 0
2: 7
3: 47
4: 511
Right 1032718022 7:134527567-134527589 CTTCTTAAGCAGCCTGTGGCCGG 0: 1
1: 1
2: 1
3: 13
4: 164
1032718017_1032718022 1 Left 1032718017 7:134527543-134527565 CCTCCCACTGTAGATAGCAGCAG 0: 1
1: 0
2: 0
3: 10
4: 143
Right 1032718022 7:134527567-134527589 CTTCTTAAGCAGCCTGTGGCCGG 0: 1
1: 1
2: 1
3: 13
4: 164
1032718016_1032718022 7 Left 1032718016 7:134527537-134527559 CCAACTCCTCCCACTGTAGATAG 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1032718022 7:134527567-134527589 CTTCTTAAGCAGCCTGTGGCCGG 0: 1
1: 1
2: 1
3: 13
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032718022 Original CRISPR CTTCTTAAGCAGCCTGTGGC CGG Intergenic
900160304 1:1220146-1220168 CTTCTTCACCAGCCTGAGGTTGG - Intronic
901552665 1:10007380-10007402 CTTTTTAATCAGGCTGTGGTTGG + Intronic
904615339 1:31746474-31746496 TTTCTTCAGCAGCCTGGGGGTGG - Intronic
905345384 1:37307741-37307763 CTGGTTGAGAAGCCTGTGGCTGG + Intergenic
907851642 1:58260441-58260463 CTTCCTAATTAGCCTATGGCTGG - Intronic
915012176 1:152698084-152698106 ATTCTTAAGGAGCTTGTGCCTGG - Intergenic
917531646 1:175841394-175841416 ATTCTTAAGTAGTCTATGGCTGG - Intergenic
917670315 1:177267730-177267752 CCTCTTAAGCAGTCTGTGGGTGG + Intronic
919765888 1:201127185-201127207 CACCTTCAGCAGCCTCTGGCCGG + Intergenic
920102031 1:203522667-203522689 CTTCCTGAGCAGCATGGGGCTGG + Intergenic
921421699 1:214956238-214956260 CTTCTTAAGAATCTTGAGGCTGG - Intergenic
922575186 1:226656365-226656387 TTTCTTCAGCAGCCTCTGACCGG - Intronic
923435519 1:233964331-233964353 CTTCTGAAGTGGCCTGGGGCTGG + Intronic
924636641 1:245793966-245793988 CTTCTTAAGCAGCATGCAACTGG + Intronic
1062858022 10:789225-789247 CTGCCTGCGCAGCCTGTGGCGGG - Intergenic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1064921488 10:20524023-20524045 GTTCTTAAGGATCCTGTGTCAGG - Intergenic
1065105644 10:22381200-22381222 CCTCTAAAACAGCCTGTGGGGGG - Intronic
1065945889 10:30605363-30605385 CTTCTTGGGCACCCCGTGGCAGG + Intergenic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1068776597 10:60874227-60874249 ATTGTTAATCAGCCTGTGCCAGG + Intronic
1073084447 10:100879328-100879350 CTGCATCAGCAGCCTGGGGCTGG + Intergenic
1074186804 10:111105154-111105176 CTTCTTGGGCAGGCTGTTGCTGG - Intergenic
1075555163 10:123425500-123425522 TTTCTTAAGCAACCTCTGGGTGG - Intergenic
1077095104 11:795849-795871 CTTCTGAGGCCCCCTGTGGCTGG + Intronic
1077206738 11:1348429-1348451 CTGCTTAAGCAGTGGGTGGCTGG - Intergenic
1080777434 11:35399001-35399023 CTGCATAAGCTGCCTATGGCTGG + Intronic
1080832893 11:35912683-35912705 CTACTTAAGAAGGCTGAGGCAGG + Intergenic
1083848357 11:65350299-65350321 CTATTTAAGCTGGCTGTGGCTGG - Intronic
1083967817 11:66053380-66053402 CTCCAAAAGCAGCTTGTGGCCGG + Intronic
1084485140 11:69443695-69443717 CCTCTTCCGCAGCCTCTGGCCGG - Intergenic
1086547510 11:88015134-88015156 TTTCTTAAGAAGTATGTGGCTGG + Intergenic
1087432860 11:98075570-98075592 CACAGTAAGCAGCCTGTGGCTGG - Intergenic
1091327613 11:134703008-134703030 CTTCCTCAGCAGCCTGAGCCTGG - Intergenic
1092898837 12:13039607-13039629 CTTCTTAACAAGCCTCTGGCTGG - Intergenic
1094134466 12:27109429-27109451 CTTCTGAAGCAGCTTCTTGCTGG + Intergenic
1099533992 12:83823525-83823547 CTTCATACTCAGCCTCTGGCAGG + Intergenic
1099828580 12:87811399-87811421 CTTCTTAAGCAGGGTGCTGCAGG - Intergenic
1100206890 12:92359675-92359697 TCTCTCAAGCAGCCTGAGGCTGG + Intergenic
1100322001 12:93504250-93504272 CTACTTAAGGAGGCTGAGGCAGG - Exonic
1103733670 12:123044896-123044918 CTACTTAAGGAGGCTGAGGCAGG - Intronic
1104528354 12:129546067-129546089 CTTCTGCAGAAGCCAGTGGCTGG + Intronic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1108742175 13:53349608-53349630 CTTCTGAAGCAGCATTTGACAGG - Intergenic
1111861758 13:93716278-93716300 CTTGTGAAGCAGCCTTAGGCAGG + Intronic
1112190451 13:97172188-97172210 CTCCTTAAGCACTCTGTGGCTGG - Intergenic
1112226968 13:97549250-97549272 CTGCTTAAGCAGCCTCTGGATGG - Intergenic
1114846988 14:26334412-26334434 TTTCTTAAGCAGCATTTAGCAGG + Intergenic
1115552828 14:34519994-34520016 CTTACTCAGCAGCCTGAGGCAGG - Intronic
1118045602 14:61967791-61967813 CTTCTAAAGCCTCCTGTAGCAGG - Intergenic
1123790319 15:23712954-23712976 CTTTTTAAGCAGCATTTGGGTGG + Intergenic
1125254495 15:37747302-37747324 CTACTTAAGCAGGCTGAGGCAGG + Intergenic
1125520129 15:40343839-40343861 CTTCTGAAGCCTCCTGAGGCTGG - Intergenic
1125838551 15:42775882-42775904 CTTCCAAAGCAGGATGTGGCAGG - Intronic
1127352922 15:58170776-58170798 CCTCCTAAGCATCCTGAGGCTGG - Intronic
1127963601 15:63907974-63907996 CTTCTGAAGCAGCCCATTGCTGG - Exonic
1128019037 15:64374243-64374265 CTTCTTAAAAAGTTTGTGGCCGG + Intronic
1130134463 15:81170505-81170527 CTTCTTTAGCATCAAGTGGCTGG + Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1130449523 15:84036841-84036863 CCTGTACAGCAGCCTGTGGCAGG + Exonic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1131671642 15:94626137-94626159 CCTCTTAAGAAGCCTCTGGGTGG + Intergenic
1132985427 16:2764389-2764411 CTTCCAAAGAAGCCTGTGACTGG - Exonic
1133113542 16:3563704-3563726 CTTCTTGAGCAGCCCATGGAAGG + Exonic
1133774442 16:8886149-8886171 GTTCTCCAGCAGCCAGTGGCCGG + Intergenic
1134272603 16:12746469-12746491 CATCATCAGCAGCCTGGGGCTGG + Intronic
1138349136 16:56337274-56337296 CTGCTGAAGCAGCATGGGGCCGG + Intronic
1138826897 16:60331830-60331852 CTTCTAAAGGGGCCTGAGGCAGG + Intergenic
1139518512 16:67465944-67465966 CTTCTCAAGGAGCCTGGGGAGGG - Intronic
1140635405 16:76907256-76907278 CATGTTTAGTAGCCTGTGGCAGG + Intergenic
1143155913 17:4835916-4835938 TTTCTTAAGCAGCTTAAGGCAGG - Intronic
1147843937 17:43391861-43391883 CTACTTAGGCAGGCTGAGGCGGG + Intergenic
1149381778 17:56101591-56101613 CTTTTTAAGCAACCTGTCACTGG + Intergenic
1151674746 17:75591664-75591686 GTTCCTAAGCAGCCTGGAGCAGG + Intergenic
1152560417 17:81075835-81075857 CCTCATATGGAGCCTGTGGCTGG - Intronic
1153569241 18:6451835-6451857 CTTCACATACAGCCTGTGGCAGG - Intergenic
1156345263 18:36251466-36251488 CTTCTTAAGGAGGCTGAGGAGGG + Intronic
1156445717 18:37235386-37235408 CTTCTGAAGCACCCTGGGCCTGG - Intergenic
1158836444 18:61335126-61335148 CTTCCTCAGCCGCCTCTGGCTGG + Intronic
1160969663 19:1761962-1761984 CCTCTCCAGCAGCCTGTGCCAGG - Intronic
925326832 2:3029226-3029248 CTTATTAAACAGCCTGGTGCGGG - Intergenic
925646000 2:6037499-6037521 CCTCTCAAGCAGCCTATGGTGGG - Intergenic
926977141 2:18526406-18526428 CTTGTTAAACAGGCTGTGACGGG + Intergenic
930596995 2:53401285-53401307 CTCCTCCAGCAGCCTGTTGCAGG - Intergenic
930846946 2:55916693-55916715 CTACCTAATCAGCCTCTGGCAGG + Intronic
931355956 2:61537903-61537925 CTTCTGCTGCTGCCTGTGGCTGG - Exonic
932978939 2:76639570-76639592 CTTCATAAGTAGCCTGTTGAGGG - Intergenic
936443298 2:112574994-112575016 CATTTTAAGCAGATTGTGGCCGG + Exonic
936589778 2:113792593-113792615 CTACTTTAGCATCCTGTGGAAGG - Intergenic
938753165 2:134354714-134354736 CTTCCTAAGCAGCTTCTGGAGGG + Intronic
946415449 2:219537803-219537825 TTTCTGAACCAGCCTGTGGAGGG + Intronic
946586976 2:221200592-221200614 CTTCATAAGCAGCCTCTCTCGGG - Intergenic
948335364 2:237202997-237203019 CATGTTTAGCAGCCTGTGGGGGG + Intergenic
948811810 2:240482227-240482249 CTTCTTCTTCATCCTGTGGCTGG + Exonic
1169648487 20:7841048-7841070 CTCCTTAAACTGCCTGAGGCTGG - Intergenic
1169675443 20:8147982-8148004 CTTCTAAAGGAGGCTGAGGCAGG - Intronic
1170709727 20:18779349-18779371 CATCTGAAGCAGCCTGTGTAAGG - Intergenic
1171227174 20:23451503-23451525 ATATTTAAGCAGCCTGTGGGAGG - Intronic
1173913586 20:46689300-46689322 CTTCTTGAGCGGCCTGGAGCTGG - Exonic
1174292038 20:49516125-49516147 CTTCTTTGGGAGGCTGTGGCAGG - Intronic
1180912866 22:19465105-19465127 CTTTTTAAGCAGCGTATGCCTGG - Intronic
1181480425 22:23195479-23195501 CTACTCAAGGAGGCTGTGGCAGG + Intronic
1183299483 22:37051904-37051926 CTTCCTCAGCCGCCTGTGCCAGG + Exonic
1183932974 22:41246618-41246640 CGTCTGCAGCAGACTGTGGCGGG + Exonic
949129619 3:484046-484068 CTTCTTAACCTGCCAGTCGCAGG - Intergenic
949548407 3:5092132-5092154 CTTCATAGGCAAGCTGTGGCAGG + Intergenic
949603381 3:5626582-5626604 TTGCTTTTGCAGCCTGTGGCAGG + Intergenic
949946113 3:9191430-9191452 ATTCTTCAGCATCCTGTGGATGG - Intronic
951375236 3:21906679-21906701 ATTGTTAAACAGCCTGTGTCTGG - Intronic
951744565 3:25962788-25962810 CTTCTTCAAATGCCTGTGGCTGG - Intergenic
952313303 3:32209893-32209915 CTTCTTAACCATCCTGTAGTAGG - Intergenic
955946376 3:64198436-64198458 CTTCTTAAACAACATGGGGCTGG + Intronic
959018689 3:101165017-101165039 CTTATTAAGGCTCCTGTGGCAGG + Intergenic
959117494 3:102195362-102195384 TTTCTGAAGCAGCCTGAAGCAGG - Intronic
960977842 3:123193726-123193748 CTTATCAGGCAGACTGTGGCAGG - Intronic
964385586 3:156144513-156144535 CTTCTAAAGCAGGATGTGGTAGG - Intronic
964783498 3:160367432-160367454 CTGCTTAAGCAGCATGTGAGGGG - Intronic
966807212 3:183817130-183817152 CCTCTTGAGAAGCCTGTGGAAGG - Exonic
966838766 3:184070717-184070739 ATTCTAAAACAGCCTTTGGCTGG + Intergenic
970665921 4:18336546-18336568 CTTCATCAGCAGCATATGGCTGG - Intergenic
970935412 4:21564692-21564714 CTTCTTTTACAGCCTGTGGGAGG - Intronic
973844175 4:54893901-54893923 CATCATAAGCAACCAGTGGCTGG + Intergenic
976221399 4:82759367-82759389 CTTGTGAAGCTGCCTGGGGCAGG - Intronic
984231573 4:177106868-177106890 CTTCTTAAGAAGCCAGAGGAAGG - Intergenic
984672464 4:182506459-182506481 CTTTTTAAGCACCATGTGCCAGG - Intronic
988214913 5:28259322-28259344 CTACTTAAGGAGACTGAGGCAGG + Intergenic
988475157 5:31578221-31578243 TTTCTAAAGGAGTCTGTGGCCGG - Intergenic
992280338 5:75168578-75168600 TTTCATAATCAGCCTGAGGCAGG - Intronic
992404235 5:76441547-76441569 CTTCTTATAAAGCCAGTGGCAGG + Intronic
993488188 5:88512944-88512966 CTTCTTACTCAGGCTGAGGCGGG - Intergenic
999100745 5:149023829-149023851 CTTTTTAACCAGGCTGAGGCAGG - Intronic
999734944 5:154506082-154506104 TTTCTTTAGCAGCCTGAAGCTGG - Intergenic
999804439 5:155068766-155068788 ATTGTTAAGCAGGCTGTGACGGG - Intergenic
1001990808 5:176114142-176114164 CTCACTAAGCAGCCTGTGGAGGG - Exonic
1002168373 5:177361896-177361918 CTTCTCAAGCAGGCTGAAGCAGG + Intronic
1002226066 5:177723998-177724020 CTCACTAAGCAGCCTGTGGAGGG + Exonic
1002267779 5:178047212-178047234 CTCACTAAGCAGCCTGTGGAGGG - Exonic
1003505762 6:6739066-6739088 CTACTCAAGCAGCCTATGGCAGG + Intergenic
1003778618 6:9398044-9398066 ATTCTTAAGCTGGCTGTAGCTGG + Intergenic
1004141770 6:13024698-13024720 ACTATTAAGCAGCCTGTGGTCGG + Intronic
1004458083 6:15810173-15810195 CCTCTTAAGCAACCAGTAGCAGG - Intergenic
1006439979 6:34047897-34047919 CTTCAAAAGGAGCCTGTGGCTGG - Intronic
1015704887 6:136077024-136077046 CTTCTTATGTACCCTGTGCCAGG + Intronic
1015990818 6:138940632-138940654 CTACTTAAGGAGGCTGAGGCAGG + Intronic
1016908773 6:149176841-149176863 CTACTTAAAGAGCCTGTGGTAGG - Intergenic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1017085481 6:150709221-150709243 CTACTTAAGGAGGCTGAGGCAGG + Intronic
1017528005 6:155259661-155259683 CTTCTTAAGCAGACTATCACTGG + Intronic
1017791776 6:157805971-157805993 CTTCATACCCAGCCTGTGGCCGG - Intronic
1018978163 6:168581454-168581476 CTTCTGAAGCTGCAGGTGGCAGG - Intronic
1019019454 6:168905622-168905644 CTCCTAAAGCAGCCTGTGTCAGG + Intergenic
1023718874 7:43072595-43072617 CTTTTTAAGCAGCCAGTGGCCGG + Intergenic
1024226930 7:47332496-47332518 CTTCTGAAGCAGCCTGTGGCTGG - Intronic
1026883584 7:73922526-73922548 CTTCCTAAGCACCCTTTGGTGGG + Intergenic
1029469633 7:100746114-100746136 CTACTTAAGGAGGCTGAGGCGGG + Intronic
1031340684 7:120596291-120596313 CTTTTTAAGCAGACATTGGCTGG - Intronic
1031964247 7:128016108-128016130 CTATTTAAGCAGCCTAGGGCTGG - Intronic
1032614333 7:133450273-133450295 CTACTCAAGGAGCCTGAGGCAGG - Intronic
1032718022 7:134527567-134527589 CTTCTTAAGCAGCCTGTGGCCGG + Intergenic
1033093286 7:138406532-138406554 CTTCTTCAGGAGGCTGAGGCAGG - Intergenic
1037763958 8:21760315-21760337 CTGCTTCAGCAGCCTGTGACTGG - Intronic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1041202785 8:55467098-55467120 CTTCCCAAGCTCCCTGTGGCTGG + Intronic
1041747815 8:61228509-61228531 CTTATAAAGCAGCCTATAGCTGG + Intronic
1045828518 8:106429547-106429569 CTACTTGAGGAGCCTGAGGCAGG + Intronic
1046038054 8:108867856-108867878 CTTTTTAGGAAGCTTGTGGCTGG - Intergenic
1055979067 9:81983733-81983755 CATTTTAAGCAGCCTGTGGGAGG - Intergenic
1057107395 9:92432593-92432615 CTTCTTCTGCAGCCTGTGATTGG - Intronic
1058904596 9:109471749-109471771 CTTCTTAGGATGCCTGAGGCAGG - Intronic
1059122164 9:111650790-111650812 CTTCTTAAGCAGGTTTTGGCTGG - Intronic
1059935333 9:119304654-119304676 CATTTTCAGCACCCTGTGGCAGG - Intronic
1060213608 9:121725219-121725241 CTTCTTAATCAGCCTATTTCTGG + Intronic
1061397541 9:130351602-130351624 CTTCCTGAGTAGCCTGTGGCGGG - Intronic
1062065088 9:134522376-134522398 CCTCCTAAGCAGCCTCTGCCAGG - Intergenic
1062331821 9:136048233-136048255 CTTCCCCAGCAGCCTCTGGCTGG + Intronic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1187040401 X:15589022-15589044 CTTCTTGAGCTACCTGGGGCTGG - Intronic
1188617228 X:32173122-32173144 CATTTTCAGCAGCATGTGGCAGG + Intronic
1192594264 X:72389689-72389711 TTTCTTTTGGAGCCTGTGGCTGG - Intronic
1198691437 X:139289243-139289265 CTTGTTCAGCATCCTATGGCTGG - Intergenic