ID: 1032720400

View in Genome Browser
Species Human (GRCh38)
Location 7:134546784-134546806
Sequence CCCCTAGGTTGAGGGAGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032720394_1032720400 -3 Left 1032720394 7:134546764-134546786 CCTACTGTCTAGTTACCGTGCCC No data
Right 1032720400 7:134546784-134546806 CCCCTAGGTTGAGGGAGATCAGG No data
1032720392_1032720400 13 Left 1032720392 7:134546748-134546770 CCCGGAGGGGACGCATCCTACTG No data
Right 1032720400 7:134546784-134546806 CCCCTAGGTTGAGGGAGATCAGG No data
1032720391_1032720400 16 Left 1032720391 7:134546745-134546767 CCACCCGGAGGGGACGCATCCTA No data
Right 1032720400 7:134546784-134546806 CCCCTAGGTTGAGGGAGATCAGG No data
1032720385_1032720400 28 Left 1032720385 7:134546733-134546755 CCTTCGGTCACCCCACCCGGAGG No data
Right 1032720400 7:134546784-134546806 CCCCTAGGTTGAGGGAGATCAGG No data
1032720393_1032720400 12 Left 1032720393 7:134546749-134546771 CCGGAGGGGACGCATCCTACTGT No data
Right 1032720400 7:134546784-134546806 CCCCTAGGTTGAGGGAGATCAGG No data
1032720390_1032720400 17 Left 1032720390 7:134546744-134546766 CCCACCCGGAGGGGACGCATCCT No data
Right 1032720400 7:134546784-134546806 CCCCTAGGTTGAGGGAGATCAGG No data
1032720389_1032720400 18 Left 1032720389 7:134546743-134546765 CCCCACCCGGAGGGGACGCATCC No data
Right 1032720400 7:134546784-134546806 CCCCTAGGTTGAGGGAGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032720400 Original CRISPR CCCCTAGGTTGAGGGAGATC AGG Intergenic
No off target data available for this crispr