ID: 1032723271

View in Genome Browser
Species Human (GRCh38)
Location 7:134568236-134568258
Sequence TATGAGAATCAACATGAGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032723267_1032723271 -1 Left 1032723267 7:134568214-134568236 CCACATTGACTGTGCCTATTTCT 0: 1
1: 1
2: 0
3: 18
4: 250
Right 1032723271 7:134568236-134568258 TATGAGAATCAACATGAGGTGGG 0: 1
1: 0
2: 1
3: 17
4: 155
1032723266_1032723271 18 Left 1032723266 7:134568195-134568217 CCATTGATGCAGAATATCGCCAC 0: 1
1: 1
2: 1
3: 2
4: 33
Right 1032723271 7:134568236-134568258 TATGAGAATCAACATGAGGTGGG 0: 1
1: 0
2: 1
3: 17
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032723271 Original CRISPR TATGAGAATCAACATGAGGT GGG Exonic
902519764 1:17009620-17009642 TAGGAGGATCAGCATGAGGCCGG - Intronic
902714673 1:18264378-18264400 AATGACAATAAACATGAGTTGGG - Intronic
904714986 1:32460919-32460941 CATGAGAATCAACTTGAGCCTGG - Intergenic
907618300 1:55947984-55948006 TATGAGAATCAGTATGGAGTGGG - Intergenic
909821506 1:80068265-80068287 AATGAAAAACAACTTGAGGTGGG - Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915926256 1:160022115-160022137 CATGAGAATCAACTTGAGCCTGG + Intergenic
916486034 1:165259479-165259501 TATGAGAACCAAAATGATGTGGG - Intronic
916890719 1:169109753-169109775 TAAGAGCACCAAGATGAGGTGGG + Intronic
917148328 1:171916938-171916960 TCTGAGAAGAAATATGAGGTAGG - Intronic
917656392 1:177130445-177130467 TAAGAGTATCAACATTAGGTAGG - Intronic
917950988 1:180036016-180036038 TATGAGCATTAACAGGAGCTTGG + Intronic
921006642 1:211100318-211100340 CATGAGAAGTAATATGAGGTTGG - Intronic
922062744 1:222107626-222107648 GATGTGGATCAACAAGAGGTGGG - Intergenic
924473814 1:244366458-244366480 TATTAAAATAAACATGAGGCTGG - Intronic
1065475646 10:26135450-26135472 AAGGAGAATCAACATAAGGCAGG + Intronic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1068010065 10:51437222-51437244 TATGAGAATAAATAAAAGGTAGG - Intronic
1069371289 10:67750428-67750450 TATCAGAATGAACATGAGGTGGG + Intergenic
1071670080 10:87600138-87600160 TAAGAAAATCAGCAAGAGGTGGG - Intergenic
1073715804 10:106106014-106106036 TAAGAGAATTGATATGAGGTTGG + Intergenic
1074052652 10:109894173-109894195 TAGGACAGTCAACATGATGTAGG + Intronic
1075492389 10:122882950-122882972 AATCAGAATTAACATGAGGGAGG - Intergenic
1075934129 10:126325138-126325160 TATGAGAAGAAACATGAGAACGG + Intronic
1077893827 11:6439217-6439239 CATACGAATCTACATGAGGTTGG - Intronic
1078540784 11:12211446-12211468 AGTGAGAATCAGCATGAGGCTGG + Intronic
1079339429 11:19599777-19599799 TTTGAGAAACAGCATGAGGGAGG + Intronic
1081184112 11:40021135-40021157 TAAGAGAATCAACATAAAATTGG - Intergenic
1082099183 11:48157765-48157787 TATCACAAGCAACATGAGGATGG - Intronic
1082695500 11:56358899-56358921 TTTGAGAATCAAACTGAGATCGG + Intergenic
1084232492 11:67763090-67763112 TATGAGAATTATGCTGAGGTAGG - Intergenic
1085936812 11:81155881-81155903 CATGAGAATTAATATGAAGTTGG - Intergenic
1086926529 11:92646631-92646653 TAAGAAAATCAACATGAGGAAGG + Intronic
1087234056 11:95698348-95698370 TATGAGAATAAACCTGAAATGGG + Intergenic
1090423988 11:126594431-126594453 TAGGAGAAAGAACATGAGTTTGG + Intronic
1090432211 11:126655520-126655542 GAAGAGAAACAACTTGAGGTGGG - Intronic
1090768941 11:129902263-129902285 TATGAGAACAGACATGAGGTGGG + Exonic
1093611469 12:21164401-21164423 GAGGAGAACCAACAGGAGGTGGG - Intronic
1093984538 12:25514756-25514778 TATGAGAATTATTATGAGATAGG + Intronic
1095751829 12:45720965-45720987 AATTAGAATCTGCATGAGGTAGG - Intergenic
1095975414 12:47937906-47937928 TCTGAGAATCAAGATGACCTTGG - Intronic
1099715747 12:86291311-86291333 CATGAGCATGAACATGAGATGGG + Intronic
1100778152 12:97994827-97994849 TCTTAGAAACAACATGGGGTGGG + Intergenic
1103706386 12:122875935-122875957 CATGAGAATGATCAAGAGGTTGG - Intronic
1104178138 12:126352164-126352186 CATCAGAACCACCATGAGGTGGG - Intergenic
1105310613 13:19205582-19205604 TATTAAAATTAATATGAGGTAGG - Intergenic
1106751929 13:32781604-32781626 TATGAAAATGAATTTGAGGTGGG - Intergenic
1107293378 13:38882746-38882768 TATGGGAATGAACATGAATTAGG + Exonic
1107447991 13:40485188-40485210 TGAGAGAATAAACATGAGTTGGG - Intergenic
1112546968 13:100380653-100380675 TATACTAATCAATATGAGGTAGG - Intronic
1114876166 14:26721103-26721125 TGTGAGAATGAACTAGAGGTAGG - Intergenic
1115533323 14:34346487-34346509 TATGAAAAATAACTTGAGGTGGG - Intronic
1116277736 14:42858136-42858158 TATGAGACTCAACATTCAGTAGG - Intergenic
1117728764 14:58700173-58700195 TATAAGAAACAACAGGAGTTTGG - Intergenic
1118458910 14:65970492-65970514 TGTGAGTATCAACATGAAGGAGG + Intronic
1118524519 14:66623937-66623959 TATCAGAAGCTACATGAGGGAGG + Intronic
1121812645 14:96904949-96904971 AATAAGAATCCAAATGAGGTTGG + Intronic
1125064295 15:35463288-35463310 TATGAGAATAAACATCATGAAGG - Intronic
1130388955 15:83437834-83437856 TATCAGATTTAACATGAAGTTGG - Intergenic
1131140938 15:89976699-89976721 TATAAGAAGCAAGATGAGGCTGG + Intergenic
1131717156 15:95124326-95124348 TGTGTGAATCAAGATGAGGAAGG - Intergenic
1137792745 16:51188573-51188595 TATAAGAATGAGCATGAAGTAGG - Intergenic
1137901676 16:52275370-52275392 TAAGAGAATAAACATCAGATCGG - Intergenic
1137901678 16:52275424-52275446 TAAGAGAATAAACATCAGATCGG - Intergenic
1137945125 16:52726539-52726561 TATGAGATTATACATGAGGGAGG - Intergenic
1140620572 16:76726050-76726072 TGGGAGAGTCAAGATGAGGTGGG - Intergenic
1140992770 16:80230451-80230473 AATGAGAATCAGCATCAGGCTGG - Intergenic
1142419879 16:89963651-89963673 TATGTGAATCTCCATGGGGTGGG + Intronic
1145867309 17:28249598-28249620 TTTAAGAATCAACCTGAGGTTGG - Intergenic
1146491356 17:33285210-33285232 TATCAGAATCATCCTGATGTTGG + Intronic
1147924769 17:43939463-43939485 TTTAAGAATCAACCTGAGGCTGG + Intergenic
1147936678 17:44015323-44015345 TATGAGACTCATCATGAAATGGG + Intronic
1150426352 17:65080006-65080028 TATAAGAAAAAAAATGAGGTCGG - Intergenic
1156424035 18:36989225-36989247 TTTGAGAATAAAAATGAGGTTGG + Intronic
1156507189 18:37605305-37605327 TCTGAGAATAAAAATGAGCTGGG + Intergenic
1157969947 18:52255245-52255267 GATGAGATTCAAGATGAGATTGG - Intergenic
1158039385 18:53073940-53073962 TGTCAGAATCAACATGTAGTAGG - Intronic
1158316841 18:56220681-56220703 CATGAGAATGAATGTGAGGTCGG - Intergenic
1158895902 18:61912571-61912593 ATTGAGAATCTACTTGAGGTAGG - Intergenic
1159439229 18:68456094-68456116 TGTGAGAATGAAGATGAGGTGGG + Intergenic
1159728365 18:71992918-71992940 TATGAGTAAGAACATGCGGTGGG + Intergenic
1160192888 18:76729492-76729514 CATGAGAGTCAACAGGAAGTGGG - Intergenic
1162060492 19:8091730-8091752 TATGAGCTTCAGCACGAGGTGGG + Intronic
1162432592 19:10637912-10637934 CATGAGAAACATCATCAGGTCGG + Exonic
1164926236 19:32132133-32132155 TATGAGATACCCCATGAGGTAGG + Intergenic
1164926285 19:32132413-32132435 TATGAGATACCTCATGAGGTAGG + Intergenic
1165178885 19:33950769-33950791 CATGAGAATTAAAATTAGGTGGG - Intergenic
1167842145 19:52130970-52130992 AATGAGAATCAACTTGGGGCTGG + Intronic
926218093 2:10917651-10917673 TATGAGAATCAGAATGGGGTGGG - Intergenic
926450498 2:12998290-12998312 ATTGAGAATCAACATTATGTGGG - Intergenic
933210693 2:79565307-79565329 CCTGAGATTCAACCTGAGGTGGG - Intronic
936404459 2:112189764-112189786 ATTGGGAATCATCATGAGGTGGG - Intergenic
936663132 2:114564457-114564479 AATGAGAATCAATATGAAATAGG - Intronic
936936889 2:117847593-117847615 TACAAGAATCATGATGAGGTAGG - Intergenic
939740930 2:145904582-145904604 TCTGAGAATGAACATGATGGAGG - Intergenic
941049403 2:160715398-160715420 CATGTGAAACAACATGAGTTGGG + Intergenic
945528894 2:210925746-210925768 TCAGAGAATCAACATGGGGCAGG + Intergenic
945629926 2:212261346-212261368 TATGAGGATCAATCTTAGGTAGG + Intronic
948966857 2:241388982-241389004 TATAAGAATAGACATGAGGCGGG + Intronic
1168955754 20:1833050-1833072 TATCATCATCATCATGAGGTGGG - Intergenic
1170989315 20:21287515-21287537 TCTGAGGATAAGCATGAGGTTGG + Intergenic
1175538210 20:59730036-59730058 TATGAGAACCAAAAGGAGATGGG - Intronic
1177616737 21:23532335-23532357 TATGAAATTCAAGATGAGATTGG - Intergenic
1178027780 21:28487875-28487897 TATGAGAAGGAACATAGGGTTGG + Intergenic
1179433234 21:41339997-41340019 TTTGAGAATCAATAGGAGATGGG + Intronic
1180164259 21:46013285-46013307 TATGAGAATGAAAACAAGGTTGG - Intergenic
1181910055 22:26231445-26231467 ATTGAGAATCAAGCTGAGGTAGG - Intronic
1182085012 22:27555526-27555548 TTTGAAAAACAACATGAGCTGGG - Intergenic
1182847125 22:33440536-33440558 TATTAGAATAAATATGAGGTTGG - Intronic
1183811178 22:40259053-40259075 TATGAGAATAAACAAGAAGTTGG - Intronic
950194408 3:10999004-10999026 TTTCAGAAGCAGCATGAGGTTGG - Intronic
951678626 3:25271109-25271131 TTTTAGCATCAAAATGAGGTTGG + Intronic
952685194 3:36139543-36139565 TATGAGATTCAGCAAGAGGAAGG + Intergenic
960107793 3:113816780-113816802 TATGAAAAATAACATGAGGCCGG + Intergenic
963865405 3:150355388-150355410 GATTAGATTCAAGATGAGGTAGG - Intergenic
964906332 3:161724170-161724192 TATGAGAATTATCCTGAGATAGG + Intergenic
969351847 4:6602761-6602783 TGGGAGAATCAACTTGAGCTTGG - Intronic
970768065 4:19575523-19575545 TATCAGAAACAACAAGAAGTGGG + Intergenic
971494457 4:27249271-27249293 GTTGAGAATAGACATGAGGTAGG - Intergenic
971965115 4:33544241-33544263 TATGAGGATAAACTTTAGGTAGG - Intergenic
974616063 4:64284058-64284080 TAGGAGAATACACATGGGGTTGG + Intronic
974885680 4:67814191-67814213 CCTGAGAATCAATATGAGGATGG - Intergenic
978203135 4:106046730-106046752 TCTGAGAAAAAACATGAGGTTGG - Intronic
978303612 4:107297423-107297445 TATGACAATCGCCAGGAGGTAGG + Intergenic
980307680 4:131084338-131084360 TAAGAGTATAAACATGAGATAGG + Intergenic
980692237 4:136310309-136310331 TATGAGTGACAACATGCGGTGGG + Intergenic
980910765 4:138992240-138992262 TTTGACAATCAACATCAGATAGG - Intergenic
981585955 4:146302601-146302623 AATGAGAAACAAGTTGAGGTGGG + Intronic
981978924 4:150768270-150768292 TAGAGGAATCAACATGAGGAAGG + Intronic
982383947 4:154780478-154780500 TTAGAGAATCAACATGAGCTAGG + Intergenic
983784220 4:171712109-171712131 TATGAGAATGAAATTGAGGTAGG + Intergenic
986874385 5:12089772-12089794 AATATGTATCAACATGAGGTAGG + Intergenic
987047541 5:14122132-14122154 TATCAGAATCATCCTGAGTTTGG + Intergenic
988428037 5:31086864-31086886 TATGAGAATGACCTTGAGGTAGG + Intergenic
991309154 5:65215773-65215795 GATGAGACTTAACATGAGGGTGG + Intronic
992235576 5:74705694-74705716 TCTGAGAAACTACATGAAGTAGG + Intronic
992764694 5:79986784-79986806 CATGAGAATAAAAATGAAGTCGG + Intronic
993061202 5:83041217-83041239 AATGAGAAACAACATGTGGATGG - Intergenic
994508087 5:100666788-100666810 TATAGGAATCAACATAAGATGGG - Intergenic
996534399 5:124562167-124562189 AATGTGAATCAACTTGAGATTGG - Intergenic
1002924541 6:1597370-1597392 ACTGAGAATTAACATGAGGATGG - Intergenic
1009754882 6:67924280-67924302 TTTGAGAAACAACCTGAGGTGGG + Intergenic
1011330284 6:86197307-86197329 AATGAGAATCACAATGAGGGGGG + Intergenic
1012940013 6:105405464-105405486 TTTGATAAGCAACTTGAGGTGGG - Intergenic
1014226561 6:118854647-118854669 TATGAAAACCTACATGAGGCTGG - Intronic
1014725941 6:124971954-124971976 TTTGGGAATCAACAACAGGTAGG - Intronic
1015806567 6:137115782-137115804 TATGAGAACCCACATGTGCTGGG + Intergenic
1020743410 7:12050963-12050985 TATTAAAATCAACATTTGGTTGG - Intergenic
1023555828 7:41421914-41421936 GATTAGAAGCATCATGAGGTAGG - Intergenic
1026676064 7:72429200-72429222 TATCTGAATCCACTTGAGGTTGG - Intronic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1028895561 7:96037533-96037555 TATTAGAATCAACATGGCATAGG + Intronic
1029343370 7:99961896-99961918 TATTAGAAACAACATGATGGGGG - Intergenic
1030409500 7:109157665-109157687 GGTGAGAATCAATATGAGGCAGG + Intergenic
1032718443 7:134530721-134530743 TATCAGAATGAACATGAAGTGGG + Exonic
1032723271 7:134568236-134568258 TATGAGAATCAACATGAGGTGGG + Exonic
1033585239 7:142770033-142770055 TCTGAGAATCAGCAGTAGGTAGG - Intergenic
1036205294 8:6801100-6801122 TATGAGAGTCAACAGGATGTCGG + Intergenic
1038353059 8:26798483-26798505 AATGAGAATAAGCAGGAGGTAGG - Intronic
1039463655 8:37766574-37766596 AATAATAATAAACATGAGGTTGG - Intronic
1044550090 8:93502451-93502473 TGTCAGAATCAAAATGAGGGTGG - Intergenic
1046175850 8:110574089-110574111 AATGAGAATTAATATTAGGTTGG + Intergenic
1047051822 8:121121296-121121318 TAGGAGAATAAAGCTGAGGTGGG + Intergenic
1047896383 8:129370772-129370794 TCTGAGAATTCACATGAGGGAGG + Intergenic
1060048877 9:120362649-120362671 TGTGAGAACCAACATAAGATGGG - Intergenic
1060468161 9:123926264-123926286 TATTAAAATAAACATGAGGCTGG + Intronic
1060917960 9:127402605-127402627 CATGAGAAGCAGCATGAGGGAGG - Exonic
1186575004 X:10755849-10755871 TATGAGAACAAAATTGAGGTGGG + Intronic
1187185667 X:16982818-16982840 TATCAGAATGAAAATGATGTGGG + Intronic
1188789019 X:34385607-34385629 TATTAGAAGCACCATGAGCTTGG + Intergenic
1194449479 X:94027134-94027156 GATGCTAATCAACAGGAGGTAGG - Intergenic
1196534295 X:116823974-116823996 TATGTTAATGAACATTAGGTTGG - Intergenic
1196855669 X:119981390-119981412 TATGGAAATGAAGATGAGGTAGG + Intergenic
1201540173 Y:15097352-15097374 TAAAAGAAACAACATAAGGTGGG + Intergenic