ID: 1032728685

View in Genome Browser
Species Human (GRCh38)
Location 7:134616162-134616184
Sequence GAGCTCCCTGGGTCAAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032728681_1032728685 1 Left 1032728681 7:134616138-134616160 CCAGCTTCTCTGCAAGAGAGTCC No data
Right 1032728685 7:134616162-134616184 GAGCTCCCTGGGTCAAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032728685 Original CRISPR GAGCTCCCTGGGTCAAGAAA AGG Intergenic
No off target data available for this crispr