ID: 1032730628

View in Genome Browser
Species Human (GRCh38)
Location 7:134638715-134638737
Sequence GGAGGAATTCAATGAATAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032730625_1032730628 1 Left 1032730625 7:134638691-134638713 CCTAACACAAGTTCTTGAACATT No data
Right 1032730628 7:134638715-134638737 GGAGGAATTCAATGAATAATTGG No data
1032730624_1032730628 12 Left 1032730624 7:134638680-134638702 CCTTCAAAATTCCTAACACAAGT No data
Right 1032730628 7:134638715-134638737 GGAGGAATTCAATGAATAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032730628 Original CRISPR GGAGGAATTCAATGAATAAT TGG Intergenic
No off target data available for this crispr