ID: 1032738494

View in Genome Browser
Species Human (GRCh38)
Location 7:134714366-134714388
Sequence CAGAGGAAGGACAAGTCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032738494_1032738499 -8 Left 1032738494 7:134714366-134714388 CCAGCCGACTTGTCCTTCCTCTG No data
Right 1032738499 7:134714381-134714403 TTCCTCTGGCAGGTTCTCCCTGG No data
1032738494_1032738501 2 Left 1032738494 7:134714366-134714388 CCAGCCGACTTGTCCTTCCTCTG No data
Right 1032738501 7:134714391-134714413 AGGTTCTCCCTGGTCCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032738494 Original CRISPR CAGAGGAAGGACAAGTCGGC TGG (reversed) Intergenic
No off target data available for this crispr