ID: 1032738763

View in Genome Browser
Species Human (GRCh38)
Location 7:134717619-134717641
Sequence GAGCCTGAGCACAGGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032738763_1032738771 1 Left 1032738763 7:134717619-134717641 CCCGCCTCCCTGTGCTCAGGCTC No data
Right 1032738771 7:134717643-134717665 GGGTCCATAAAGTCAAAGTGAGG No data
1032738763_1032738775 25 Left 1032738763 7:134717619-134717641 CCCGCCTCCCTGTGCTCAGGCTC No data
Right 1032738775 7:134717667-134717689 GTTTGACTCCATGATAGGGAAGG No data
1032738763_1032738774 21 Left 1032738763 7:134717619-134717641 CCCGCCTCCCTGTGCTCAGGCTC No data
Right 1032738774 7:134717663-134717685 AGGAGTTTGACTCCATGATAGGG No data
1032738763_1032738773 20 Left 1032738763 7:134717619-134717641 CCCGCCTCCCTGTGCTCAGGCTC No data
Right 1032738773 7:134717662-134717684 GAGGAGTTTGACTCCATGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032738763 Original CRISPR GAGCCTGAGCACAGGGAGGC GGG (reversed) Intergenic
No off target data available for this crispr