ID: 1032745798

View in Genome Browser
Species Human (GRCh38)
Location 7:134784727-134784749
Sequence CAGAAGCCCAAATAGGACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032745798 Original CRISPR CAGAAGCCCAAATAGGACCA GGG Intronic
900564522 1:3325803-3325825 AAGATGGCCAAAGAGGACCAAGG - Intronic
902037247 1:13466850-13466872 CAGAAACCGAAGGAGGACCAAGG + Intergenic
902538510 1:17135921-17135943 AAAAACCCCAAATTGGACCATGG + Intergenic
903176794 1:21586313-21586335 CAGAAGCCCAAAAGTGACCATGG + Intergenic
903868474 1:26415166-26415188 CAAAAGCCCAGATTTGACCAAGG + Intronic
904012865 1:27399638-27399660 CACACACCCACATAGGACCAAGG - Intergenic
905018010 1:34790907-34790929 CAGCAGCCTGAACAGGACCAGGG + Intronic
907493952 1:54829453-54829475 CAGGAGCCCAAGTAGGGCAAAGG - Intronic
908383830 1:63621518-63621540 CACAAGCCCATATAAAACCAGGG + Intronic
910955438 1:92698535-92698557 CAGAAGACCAAAGAGTACAAAGG + Intronic
912569425 1:110610555-110610577 CTGAAGCTCAGAGAGGACCAAGG + Intronic
912615375 1:111094956-111094978 CAGAAGCCAAAATAGAAAAATGG + Intergenic
913684321 1:121216808-121216830 CAGCAGCCCAACCAGGCCCATGG - Intronic
914036160 1:144004423-144004445 CAGCAGCCCAACCAGGCCCATGG - Intergenic
914153298 1:145063522-145063544 CAGCAGCCCAACCAGGCCCATGG + Intronic
914993537 1:152518970-152518992 CAGAACCAGAAATAAGACCAAGG + Intronic
915914124 1:159931059-159931081 CAGAAGGCCAGATAGGTTCAAGG + Intronic
917387912 1:174497532-174497554 CAGAAAACCAAATGGGACAAGGG - Intronic
918057300 1:181033153-181033175 CAGAATCCCAAATTGCACCAAGG - Intergenic
919290275 1:195621299-195621321 CAGAAAACCAAATATGGCCATGG + Intergenic
920471629 1:206235321-206235343 CAGCAGCCCAACCAGGCCCATGG - Intronic
921914291 1:220589819-220589841 CAGAAACTCAAATAGTAGCATGG + Intronic
922625236 1:227033887-227033909 AAGAATCACAAATAGGACTAAGG - Intronic
922852577 1:228746504-228746526 CACAAGCCAAAATGGGAGCAAGG + Exonic
923280410 1:232438008-232438030 CATAAGCCCCAATATGACCCTGG + Intronic
923410613 1:233705250-233705272 CAGAAACCCAAATAGAGCCTGGG + Intergenic
923416286 1:233765182-233765204 CAGAAGCCAAAATAGGCAAATGG - Intergenic
1064450336 10:15436281-15436303 CAGAAGTCCAAACAGTACAAAGG + Intergenic
1065127463 10:22587382-22587404 CAGAAGCCCAGAGAGTTCCAAGG + Intronic
1067453384 10:46396512-46396534 CAGAACCCCAAACAGCACCTGGG - Intergenic
1067583851 10:47463254-47463276 CAGAACCCCAAACAGCACCTGGG + Intronic
1067633854 10:47988602-47988624 CAGAACCCCAAACAGCACCTGGG + Intergenic
1068609080 10:59038857-59038879 CAGAAGCCAAAATAGAAAAATGG - Intergenic
1069797928 10:71065056-71065078 CTGAAGCCCAAATGGGGCCCAGG + Intergenic
1072422961 10:95304801-95304823 AAAAAGCCCAGATGGGACCAAGG - Intergenic
1072542738 10:96410635-96410657 CAAAAGCACAAGTAGGACCTAGG + Intronic
1074358146 10:112803931-112803953 CAGACTCCCAGATAGGATCAAGG - Intronic
1077666727 11:4116997-4117019 CAGAAAGCCAAATAGAAACATGG + Intronic
1078639745 11:13083703-13083725 GAGCAGCCCAAACAGGTCCAGGG + Intergenic
1079186585 11:18243859-18243881 CAGCATCACAAATAGGACAAAGG - Intronic
1080584674 11:33670809-33670831 CAGAAGCCACAAAAGGACCTTGG + Exonic
1085130853 11:74037236-74037258 CAGAAGCCCATCAAGGACCTGGG + Intronic
1085523554 11:77151775-77151797 CAGAAGCCCAGAGAGGGCCAGGG + Intronic
1085824022 11:79823892-79823914 CAGAAGCAAGAAGAGGACCAAGG + Intergenic
1087525852 11:99311389-99311411 CTGAAGCCCAAATATGACAATGG - Intronic
1089973418 11:122712457-122712479 CAGCAGCCCAAATGGACCCAGGG + Intronic
1095882366 12:47151696-47151718 CTGAAGGCCAGAGAGGACCAAGG + Intronic
1098454985 12:70661920-70661942 CAGAAGCAAAAATAATACCATGG + Intronic
1098688195 12:73452244-73452266 CAGAAGCCAAAATAGACCAATGG + Intergenic
1104800728 12:131553916-131553938 CCGAAGCCCAAACACGGCCAGGG + Intergenic
1107119702 13:36782739-36782761 CATAAGCTTAAATATGACCATGG + Intergenic
1107214430 13:37899720-37899742 CAGAAACCCAAAAAGGCCAATGG + Intergenic
1108231599 13:48349864-48349886 CAGAAACCAAAATAAGAGCAGGG + Intronic
1109817970 13:67612490-67612512 CAGAAGCAAGAATAGAACCAAGG + Intergenic
1111026018 13:82525774-82525796 CAGAAGACCAGATGAGACCAGGG - Intergenic
1112712549 13:102146940-102146962 CAGAAGCTAAAATGGAACCAAGG - Intronic
1112812848 13:103238629-103238651 CAGATGGCCAAATTGGACCGAGG + Intergenic
1115092021 14:29588611-29588633 AAGAAGCACAAATACGACCATGG + Intronic
1116044735 14:39730971-39730993 AAGAAGCTCAAAAAGTACCAGGG - Intergenic
1117234197 14:53754157-53754179 CAGAAGACAAAAGAGGAGCAAGG - Intergenic
1122901097 14:104782623-104782645 CAGAGGCCCAAATGGGCCCTGGG + Intronic
1123509202 15:20979239-20979261 CAGAAACCCAATCAGGACCTAGG - Intergenic
1123566425 15:21552986-21553008 CAGAAACCCAATCAGGACCTAGG - Intergenic
1123602687 15:21990272-21990294 CAGAAACCCAATCAGGACCTAGG - Intergenic
1127444198 15:59043490-59043512 CAGAAACACAAGCAGGACCAGGG - Intronic
1128358484 15:66944380-66944402 CTGAAACCCAAAGAGGCCCAGGG + Intergenic
1128541628 15:68538781-68538803 GAGAAGTCCTAATAGGTCCAGGG - Intergenic
1129193747 15:73952415-73952437 CACGAGCCCAGATAGGAGCAGGG - Intergenic
1129461987 15:75704248-75704270 CAGAGGCCCAGATAGGGCCAGGG + Intronic
1129717295 15:77859843-77859865 CAGAGGCCCAGACAGGACCAGGG + Intergenic
1129722867 15:77887597-77887619 CAGAGGCCCAGATAGGGCCAGGG - Intergenic
1130178591 15:81601702-81601724 CAAAAGCCCAAAGAGAACAAAGG + Intergenic
1130812798 15:87398774-87398796 CAGAACAACAAATATGACCAAGG + Intergenic
1132209588 15:100010125-100010147 CAGAAGCCAAAAGAGAACAAAGG - Intronic
1136057553 16:27701665-27701687 CAGAAGCCCAATTCTGTCCATGG - Exonic
1136559776 16:31032534-31032556 CTGAAGCCTAAAGAAGACCAAGG + Intergenic
1137405853 16:48188709-48188731 CAGAAGGCCTAATTGGATCATGG - Intronic
1138390151 16:56664493-56664515 CTGAAGCCCAGAGAGGTCCATGG - Intronic
1138517067 16:57541971-57541993 CTGAAGCCCAGAGAGGACCTGGG - Intergenic
1139367326 16:66441547-66441569 GAGAAGCCCAAATGGGAACAGGG - Intronic
1139939704 16:70596389-70596411 CAGAGGCACAAAGAGGACCGTGG + Intronic
1140250546 16:73290702-73290724 CTGAAACCCAAAAAGCACCAGGG - Intergenic
1144647514 17:16985476-16985498 CAGCAGCACAAAATGGACCAAGG + Intergenic
1147980155 17:44269141-44269163 CAGAAGCCCAGAGAGGGCCAGGG - Intergenic
1150504400 17:65683429-65683451 CAGAAAACCAAAGAGGACCCCGG + Intronic
1151118229 17:71763208-71763230 CAGAGGCCCTAATAGTACCCAGG - Intergenic
1151217776 17:72589521-72589543 CAGGATCCCAAATTGGACCCTGG + Intergenic
1151783179 17:76261206-76261228 CAGAACTCCCAATAGGCCCAAGG - Intergenic
1153485128 18:5590292-5590314 CAGTAGCTCAGATAGTACCAAGG + Intronic
1154497306 18:14971552-14971574 AAGAAGCCCAAATAGCCACATGG + Intergenic
1155482494 18:26303707-26303729 CAAAAGCCCAAGTAGAGCCAAGG - Intronic
1157416684 18:47509329-47509351 TAGAAGCCCATTTAGGTCCATGG - Intergenic
1158550756 18:58433882-58433904 CAGAAGGCCAAAGACTACCAAGG - Intergenic
1158968298 18:62643067-62643089 CAGATGCCCAAATAGGCCATGGG - Intergenic
1159217788 18:65419063-65419085 CAAAAGCCAAAATAGGAAAATGG - Intergenic
1160035574 18:75298809-75298831 AAGATTTCCAAATAGGACCACGG + Intergenic
1161494366 19:4579533-4579555 CTGAAGCCCAGAAAGGACTAGGG + Intergenic
1163959108 19:20670701-20670723 CAGAAGCATAAATGGGCCCATGG + Intronic
1164720974 19:30431313-30431335 CTCAAGACCAAAAAGGACCAAGG + Intronic
1164869099 19:31628587-31628609 AAGAAGCCCAGAAAGGAACAAGG - Intergenic
1166324416 19:42040535-42040557 CTGAAGCCCAAAGAGGCCCCGGG - Intronic
1167208358 19:48117595-48117617 CAGAATCCCACACAGGGCCACGG + Intronic
1168431900 19:56288100-56288122 CACAGGCCCAAATGGGTCCATGG + Intronic
1168579495 19:57542720-57542742 CAGAAGCCGAGATAGAAGCATGG - Exonic
926160023 2:10481350-10481372 CATTAGCCCAAATAGGAAGAGGG + Intergenic
926333987 2:11849609-11849631 CAGAAGCCCAGAGAGGAGAAGGG - Intergenic
927948365 2:27150742-27150764 CAGAAGCCTAGAAAGCACCAAGG - Intronic
927971962 2:27311539-27311561 CAGAAGGCCAAGTAGGAGCCTGG - Intronic
928326073 2:30320586-30320608 CAGCAGCCCATGTAAGACCAAGG + Intronic
928692442 2:33814550-33814572 TAGAAGCCCAAATGGGAGCAAGG - Intergenic
937415485 2:121711170-121711192 CAGCAGCCTAGATAGGGCCATGG + Intergenic
939073769 2:137575541-137575563 CAGAAGAACAAATAAGACAAAGG + Intronic
942202742 2:173588440-173588462 TAGAAGCCTAAATAAGACGATGG - Intergenic
945851543 2:215014243-215014265 CAGAAGCCAGAATAGGAAAAGGG + Intronic
948363274 2:237437574-237437596 CAGGAGCTCAAATAGGACATGGG + Intergenic
948663791 2:239522336-239522358 CTGAAACCCAACTAGGACAAAGG + Intergenic
1169296575 20:4405114-4405136 CAGAAACGCAAAGAGGACAAAGG - Intergenic
1172176525 20:32975836-32975858 CAGAGGCCCAGAGAGGAGCAAGG - Intergenic
1172852933 20:37979633-37979655 CAGAAACTAAAATAGAACCACGG - Intergenic
1173658333 20:44716250-44716272 CCCAAGCCCAAACTGGACCAAGG + Intronic
1175499378 20:59439051-59439073 CAGATGCCCAAAGAGGGGCAGGG + Intergenic
1175585022 20:60132347-60132369 CAGGAGCCCAGATATGATCACGG - Intergenic
1175642769 20:60644769-60644791 CAGAAGCCCACAGAGGCCTATGG + Intergenic
1178346744 21:31835305-31835327 GAGAAGCACAAAAAGCACCATGG - Intergenic
1178885392 21:36480777-36480799 CAGAAGCCCAAGTAAGTCCCTGG - Intronic
1179474307 21:41633478-41633500 CAGCAGCCCACACAGGACCCAGG - Intergenic
1179840079 21:44066697-44066719 CAAATGTCCAAATAGGAGCAAGG - Intronic
1180087609 21:45514993-45515015 CAGAAGGACAGACAGGACCATGG + Exonic
1182085817 22:27560464-27560486 CAGAAGCTCAAAGAGGAGAAGGG - Intergenic
1185131107 22:49039343-49039365 GAGAGTCCCAAATGGGACCAGGG - Intergenic
949864021 3:8532560-8532582 GAGAAGACCAAACAGGAACATGG - Intronic
950436833 3:12985296-12985318 CAGGAGCCCAGAGAGGGCCAGGG + Intronic
953039367 3:39241397-39241419 CAGAAGATGAAATAAGACCAAGG + Intergenic
953885126 3:46710696-46710718 CAAAGGCCCAAATAGCACCTGGG + Exonic
954860563 3:53685876-53685898 AAGAAGACCAAATAAGTCCAAGG + Intronic
956392162 3:68785395-68785417 CAGGAGCCCACAGAGGAGCAGGG + Intronic
956860759 3:73321548-73321570 CAGAAGCCCAAATACCTACAGGG + Intergenic
959165540 3:102772955-102772977 CAGAAGCATAACTAGAACCAAGG - Intergenic
959879575 3:111428103-111428125 CAGAAGGCAAAGTGGGACCAAGG - Intronic
961085298 3:124062197-124062219 CAGAAGGCCACATAAGTCCAAGG - Intergenic
961265161 3:125635665-125635687 CAGCAGCCCTCAGAGGACCAGGG - Intergenic
961714981 3:128851954-128851976 CAGCAACCCAAGGAGGACCAGGG - Intergenic
962751935 3:138439998-138440020 CAGAGGCCCAGAGAGGACAAGGG - Intronic
962977092 3:140455418-140455440 CAAAAGCCCAAATGGGGCCTAGG - Intronic
963322046 3:143819463-143819485 CAGAACTACAATTAGGACCAGGG - Intronic
966101209 3:176270504-176270526 CAGAAGCCAAACTGGCACCATGG + Intergenic
967540129 3:190657492-190657514 CAGAAGCCTGAATGGGACGAAGG - Exonic
968530494 4:1088792-1088814 CAGCAGCCCAAATTGTACCTTGG - Intronic
969598512 4:8162153-8162175 CAGAACCCCCAGTAGGACCCTGG + Intergenic
974478481 4:62414651-62414673 CAGAAGGGCAAAAAGGACCCAGG - Intergenic
977728637 4:100325806-100325828 CAGAAGCCCAAATAAAATGATGG + Intergenic
978371430 4:108033230-108033252 TAGAAGCTCAAATGGGCCCATGG - Exonic
983147333 4:164233289-164233311 CAGAAGAGTAAATAAGACCAGGG - Intronic
988466047 5:31493623-31493645 CAGAAGTCCTAACAGGAGCAAGG + Intronic
988583856 5:32491891-32491913 CAGAAGACAAAATTTGACCAAGG + Intergenic
988797006 5:34660497-34660519 AAGAATCCCAAACAGCACCATGG - Intronic
993086597 5:83370608-83370630 AAGAAGCCCAAGTAGGAACAAGG - Intergenic
993820766 5:92613577-92613599 CAGAATCAAAAATAAGACCATGG + Intergenic
998296023 5:140969198-140969220 CAGGGGCCCAGACAGGACCAGGG + Exonic
998888690 5:146722928-146722950 CAAAGGCCCAAAGAGGAGCAAGG - Intronic
999010313 5:148030696-148030718 CAGAACCAGAAATAGTACCAGGG - Intronic
999193966 5:149769545-149769567 CTGAAGCCCAGAGAGGACGAGGG - Intronic
1003757340 6:9136529-9136551 AAGTAGCCCAAATAGTACCACGG - Intergenic
1006168696 6:32080977-32080999 CAGAAGCCCAGAAGTGACCATGG + Intronic
1007918352 6:45583864-45583886 CAGAAGCCCAAAGGGGAACATGG + Intronic
1008298776 6:49808599-49808621 CAGAAGGCCAAGGAGGAGCAAGG - Intergenic
1009287969 6:61846065-61846087 CGGAAGGCCAAATGGGAGCAGGG - Intronic
1009756610 6:67948166-67948188 CAAAAGCCAAAATAGGCACATGG - Intergenic
1013528834 6:111000637-111000659 CAGAAGCCCAATTTGTACCCAGG - Intronic
1015372338 6:132468160-132468182 CAGAAGCCCAAATTTAATCAGGG - Intronic
1015861025 6:137680016-137680038 CAGAAGCCAGTACAGGACCATGG - Intergenic
1021399286 7:20191290-20191312 CAGAAGTGCAAGTAGGCCCATGG - Intronic
1022823678 7:33987003-33987025 GGGAAGCTCAAGTAGGACCAGGG - Intronic
1022897730 7:34769524-34769546 CTGAAGCCTAAATAGGAGCTAGG - Intronic
1023454654 7:40324979-40325001 AATAAGCCCAAATTGGAACAAGG - Intronic
1024316064 7:48017906-48017928 CCGAAGCCCAACTGGGACAAAGG + Intronic
1027611731 7:80369592-80369614 CAGGAGCACAAATTGCACCACGG + Exonic
1028578955 7:92384865-92384887 CAAAAGCCAAAATAGAAACATGG + Intronic
1029114586 7:98230748-98230770 CAGAAGCCCCACTGGGCCCAGGG - Intronic
1029897160 7:103995261-103995283 CAAACGTACAAATAGGACCATGG - Intergenic
1032745798 7:134784727-134784749 CAGAAGCCCAAATAGGACCAGGG + Intronic
1032779514 7:135152709-135152731 CAGAAAGCCAAAGGGGACCAGGG - Intronic
1032931663 7:136679253-136679275 AAGAAGCCCAAAGAACACCAGGG + Intergenic
1034069125 7:148165645-148165667 CTGAGGCCCAAATAGGACCTGGG + Intronic
1034247678 7:149661147-149661169 AAGAAGCTCAAATAGCACCCAGG - Intergenic
1037161659 8:15780650-15780672 CAGCAGCCCGAGTAGGACCTGGG + Intergenic
1037192249 8:16140813-16140835 CAGAGGCCCAAACAGCACCAGGG + Intronic
1038414305 8:27382572-27382594 CAGAAGCAAAAATAGGCACATGG - Intronic
1040396060 8:47001376-47001398 AAGAAGCCCAAATAAAACCTAGG + Intergenic
1042280027 8:67045883-67045905 CAGAAGCCCAGCTGGGACGAGGG - Exonic
1042344242 8:67711454-67711476 CACCAGCCCAAATAGGGCCCTGG - Intronic
1042650675 8:71037352-71037374 CTGAAGTCCAAATAGGTCAAAGG + Intergenic
1045744720 8:105405155-105405177 CAGAACCCCAGGTAGGACAAGGG + Intronic
1047211813 8:122846655-122846677 CAGAAGCCATCATAGGACAAAGG - Intronic
1048235250 8:132683495-132683517 CAGAAGACCAAAAAGGAAGAGGG - Intergenic
1056380030 9:86048887-86048909 CAGAAGCCAAAATAGGCAAATGG - Intronic
1057502798 9:95609227-95609249 CAGAAGCAGAAAGAGGACAAAGG + Intergenic
1058813056 9:108659719-108659741 CAGTAGCCCAAATTGTACCTGGG - Intergenic
1060167781 9:121433622-121433644 CAGAAGCCCATAAAGGACCTCGG - Intergenic
1189464270 X:41266510-41266532 AAGAAGCCAAAATAAGAGCAAGG + Intergenic
1190383816 X:49865061-49865083 CAGAATGGCAAATAGGACCTAGG - Intergenic
1190880816 X:54491475-54491497 CAGAAGCCCACATGGGGCCCTGG + Intronic
1190888960 X:54552517-54552539 CCAAAGCCCAAGTAGGGCCAAGG - Intronic
1192829415 X:74735641-74735663 CAAAAGCCCAGCTAGCACCAAGG + Exonic
1196712812 X:118781104-118781126 CAGAAGCCCAATTAGTCACAAGG - Intronic
1196753030 X:119134575-119134597 CAGATGCCCAAATAGGCTCTAGG + Intronic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1197607403 X:128600274-128600296 CAGAAATGCAAATAAGACCAAGG + Intergenic
1199425580 X:147697439-147697461 CAGAAGCACAAAAAGAACCTGGG - Intergenic
1200058918 X:153475335-153475357 CAGGACCCCAAATGGGACAAGGG - Intronic
1200171668 X:154080655-154080677 CAGAAGGCCAAAAGGGTCCATGG - Intronic
1201490774 Y:14539091-14539113 CAGAAGTCCAAATAGGAAGTTGG + Intronic
1201507095 Y:14714098-14714120 AAGAAGCCCAAATAAAACCTAGG - Intronic
1202377528 Y:24250694-24250716 CAGAGGCCCAGACAGGACCAGGG + Intergenic
1202493253 Y:25419428-25419450 CAGAGGCCCAGACAGGACCAGGG - Intergenic