ID: 1032746068

View in Genome Browser
Species Human (GRCh38)
Location 7:134787539-134787561
Sequence CCTGCCCTAGAGAAGATGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032746068_1032746074 12 Left 1032746068 7:134787539-134787561 CCCTACATCTTCTCTAGGGCAGG 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1032746074 7:134787574-134787596 CCCTGGTTTAGATGCTTCCCTGG No data
1032746068_1032746077 16 Left 1032746068 7:134787539-134787561 CCCTACATCTTCTCTAGGGCAGG 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1032746077 7:134787578-134787600 GGTTTAGATGCTTCCCTGGGTGG No data
1032746068_1032746076 13 Left 1032746068 7:134787539-134787561 CCCTACATCTTCTCTAGGGCAGG 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1032746076 7:134787575-134787597 CCTGGTTTAGATGCTTCCCTGGG 0: 1
1: 0
2: 1
3: 16
4: 172
1032746068_1032746071 -5 Left 1032746068 7:134787539-134787561 CCCTACATCTTCTCTAGGGCAGG 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1032746071 7:134787557-134787579 GCAGGAGTCATCACAGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032746068 Original CRISPR CCTGCCCTAGAGAAGATGTA GGG (reversed) Intronic
901097543 1:6694249-6694271 CTTGCCCCATAGAAGATGTCTGG - Intronic
901198810 1:7455191-7455213 CCTGCACTAGAGAAGCAGGAGGG - Intronic
902578028 1:17390654-17390676 CCTGCCCTGGAAAAGCTGTCTGG - Intronic
905699028 1:39998104-39998126 CCTGCTTTAGAGATGATGAAGGG + Intergenic
906344745 1:45008141-45008163 CTTGCCCTAGAGTAGATTTTAGG + Intronic
907916489 1:58874691-58874713 CCTGCTCTGAGGAAGATGTATGG - Intergenic
913957757 1:143320084-143320106 CCTACCCCAGAGAAGGGGTATGG + Intergenic
914052067 1:144145448-144145470 CCTACCCCAGAGAAGGGGTATGG + Intergenic
914127130 1:144821093-144821115 CCTACCCCAGAGAAGGGGTATGG - Intergenic
920287338 1:204890122-204890144 CTTGCCTGACAGAAGATGTAGGG + Intronic
922368934 1:224890588-224890610 CCTGTCCTTGAGAAGCTATAGGG + Intergenic
1064455067 10:15479958-15479980 CCCGCCCTTTAGAAGATTTAGGG - Intergenic
1064996340 10:21299871-21299893 CCTGCCCTGGAGGAGATCTGGGG + Intergenic
1064998426 10:21316216-21316238 CCAGCCCTGCAGAAGATGTAGGG + Intergenic
1065436012 10:25704556-25704578 ACAGCATTAGAGAAGATGTACGG + Intergenic
1065944570 10:30594944-30594966 TCTGCCCAAGAGAAGATATCAGG + Intergenic
1066759917 10:38740515-38740537 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1066961700 10:42232254-42232276 CCTACCCCAGAGAAGGGGTATGG + Intergenic
1067056367 10:43054720-43054742 CCTGCCCTGGAGCAGAGGTGGGG + Intergenic
1069237526 10:66095865-66095887 CCTGCCTTAGAGAAAATCTCTGG - Intronic
1069960303 10:72075397-72075419 CCTGCCCCAGAGTGGAAGTAGGG + Intronic
1070587832 10:77779974-77779996 GCTGCCCTAGAGAAGAAGCCAGG + Intergenic
1074136377 10:110630428-110630450 CCAGCCCTAGAGAGGATCTAGGG - Intergenic
1076300445 10:129421604-129421626 GCTGCCCAAGAGAAGCTGCATGG + Intergenic
1083354869 11:62058670-62058692 TCTGCCCTAGAGAAACTGTAGGG + Intergenic
1085641965 11:78198266-78198288 CCTGCCCTAGTGATGCTGTCAGG + Intronic
1093076564 12:14764893-14764915 CCTGCCCTGGAGATGATGTTTGG - Intergenic
1095976727 12:47945286-47945308 AGTGCCCTAGAGAAGAGGGAGGG - Intergenic
1099370990 12:81829647-81829669 CCTGCCTTAGAGCAGAAGAAAGG - Intergenic
1100714972 12:97295905-97295927 CCTGCCTTAGTGAAGATTTTAGG - Intergenic
1101314704 12:103618521-103618543 CATGCCACAGGGAAGATGTATGG + Intronic
1102215845 12:111160889-111160911 CCTGCCATGGGGAAGATGCAGGG + Intronic
1105239214 13:18595557-18595579 CCTGCCTTGGAGAAGAAGGAAGG + Intergenic
1105349320 13:19601798-19601820 CCTGCCCTAGGAAAGCTGTGGGG - Intergenic
1106189802 13:27441692-27441714 CATGCCCTAGATGAGATGAATGG - Intronic
1108393289 13:49969318-49969340 TCTTCCCCAAAGAAGATGTATGG + Intergenic
1112322644 13:98421354-98421376 CCTACCCAAGAGAAAATGAAGGG - Intronic
1116987986 14:51241416-51241438 CCTGTCATAGAGAATTTGTAGGG - Intronic
1117291946 14:54343069-54343091 CCTGACTTAGAGACAATGTAAGG - Intergenic
1118139116 14:63060586-63060608 CCTGGCCCAGAGTAGGTGTATGG - Intronic
1120014394 14:79453963-79453985 TCTGCAGTAGAGAAGATGGAGGG - Intronic
1120396812 14:83977832-83977854 CCTGCTCTAGCTAAGATGGATGG + Intergenic
1122139592 14:99654556-99654578 CCTGCAGTAGAGAGGAGGTAGGG + Intronic
1122711275 14:103660145-103660167 CCTAACCTAGAGGAGATGTGAGG - Intronic
1202930628 14_KI270725v1_random:30006-30028 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1123421729 15:20141411-20141433 CCTACCCCAGAGAAGGGGTATGG + Intergenic
1123443333 15:20305125-20305147 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1123492037 15:20788527-20788549 CCTGCCTTGGAGAAGAAGGAAGG - Intergenic
1123530955 15:21147951-21147973 CCTACCCCAGAGAAGGGGTATGG + Intergenic
1123548541 15:21357617-21357639 CCTGCCTTGGAGAAGAAGGAAGG - Intergenic
1124820385 15:33039601-33039623 CCTGGCCTGGGGCAGATGTAGGG - Intronic
1124865442 15:33486272-33486294 CCTGCCCTAGAGACTTTGGAAGG - Intronic
1128282528 15:66408431-66408453 GCTGCCCTAGAGAAGCTGGGAGG - Intronic
1130362540 15:83204910-83204932 CTTGCTCTAGGGAAGATGTTTGG - Intronic
1202956875 15_KI270727v1_random:84848-84870 CCTGCCTTGGAGAAGAAGGAAGG - Intergenic
1134536902 16:15033643-15033665 CCTGCCTTAGAGAAGAGGGCGGG + Intronic
1135162006 16:20104795-20104817 ACTGCACTAGAGATGCTGTAAGG - Intergenic
1135493990 16:22935701-22935723 CTTGCTCTGGGGAAGATGTATGG - Intergenic
1136722886 16:32338762-32338784 CCTACCCCAGAGAAGGGGTATGG + Intergenic
1136841207 16:33544761-33544783 CCTACCCCAGAGAAGGGGTATGG + Intergenic
1136863114 16:33714246-33714268 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1137886179 16:52106026-52106048 CATGCTCTGGAGAAGATGTAAGG + Intergenic
1140045005 16:71434563-71434585 CCTGTCCTTGGGAAGATGCAGGG + Intergenic
1140585557 16:76287540-76287562 CATTCTCTAGAGAAGATGTCAGG + Intronic
1203003545 16_KI270728v1_random:179002-179024 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1203124600 16_KI270728v1_random:1562399-1562421 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1203135153 16_KI270728v1_random:1715409-1715431 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1203151372 16_KI270728v1_random:1845058-1845080 CCTACCCCAGAGAAGGGGTATGG + Intergenic
1142471026 17:163350-163372 CCTTCCCTAGAGAAGGGGGAAGG + Intronic
1146500536 17:33360753-33360775 CCTCCCATATAGAAGATCTATGG + Intronic
1147674117 17:42193126-42193148 CCTGGGGTAGAGAGGATGTAAGG + Intronic
1150499597 17:65637746-65637768 CCTGCCCAAGAGAAGCTCTCAGG - Intronic
1156170043 18:34471927-34471949 TCTGCCCTAGAGCATATGGAAGG - Intergenic
1156516842 18:37687421-37687443 CCTGCTCTCCAGAAGCTGTAGGG - Intergenic
1160179216 18:76619859-76619881 CCTGCGCTAGAGAAAATACACGG + Intergenic
1160540918 18:79622008-79622030 CCTGCCCTGGAGATGATTTCAGG + Intergenic
1160784888 19:895563-895585 CCTCCCCTAGAGACGCTGGAGGG + Intergenic
1161456703 19:4373231-4373253 CCAGCCCAAGGGAAGATGGAGGG + Intronic
1163846397 19:19640566-19640588 CCTCCCCTGGGGAAGATGGATGG + Exonic
1164670646 19:30070319-30070341 CCTGCTCCGGAGAAGATGAAGGG - Intergenic
1165804040 19:38569570-38569592 CCTGCTTTACAGAAGATGAAAGG - Intronic
1202691466 1_KI270712v1_random:97872-97894 CCTACCCCAGAGAAGGGGTATGG + Intergenic
925893265 2:8452970-8452992 ACTGCCACAGGGAAGATGTAAGG - Intergenic
926935899 2:18086416-18086438 CCTTCACTATAGAAGCTGTAGGG - Intronic
928247695 2:29645572-29645594 CTGGCCCTAGAGAAGTTGCATGG + Intronic
928595240 2:32853830-32853852 TCTCCCCTAGAGAAGGTGTAAGG - Intergenic
928713586 2:34034827-34034849 CCTGCCCTAGAGAAAAAATAAGG - Intergenic
930021471 2:47004432-47004454 CCTGCCCAAGGGAAGCTGTGAGG + Intronic
933954925 2:87356078-87356100 CCTACCCCAGAGAAGGGGTATGG - Intergenic
934274069 2:91564406-91564428 CCTACCCCAGAGAAGGGGTATGG + Intergenic
934323240 2:91984855-91984877 CCTACCCCAGAGAAGGGGTATGG - Intergenic
934461554 2:94215646-94215668 CCTACCCCAGAGAAGGGGTATGG - Intergenic
934936877 2:98472137-98472159 CCTGCCGTGGAGCAGAAGTATGG + Intronic
935875235 2:107499182-107499204 CCTGTCCAAGAGAGGCTGTATGG + Intergenic
941634778 2:167924819-167924841 CCTGCCCTAATGAAGATGATGGG + Intergenic
944155196 2:196600327-196600349 CCTTCCCTAGAGACCATGAAAGG + Intergenic
945054588 2:205857407-205857429 CCTTCCCTAGAGCAGATGGCAGG + Intergenic
947508260 2:230726804-230726826 CCTTCCCTACAGAAGCTGAAAGG + Intronic
948925955 2:241097982-241098004 CCTGGCTTGGAGAAGATATATGG - Intronic
1168875722 20:1171031-1171053 CCTCACCTAGAGAGGATGTGAGG - Intronic
1169285812 20:4306175-4306197 CCTGCCCTACACAAGATTTGGGG - Intergenic
1172934977 20:38613580-38613602 CCTGCCCTGGAGAAGGTCTCTGG + Intronic
1174664579 20:52246028-52246050 CCTCCACTAGTGAAGATGAAGGG + Intergenic
1174815578 20:53684309-53684331 CCTGGCCTACAGAAGATCTTTGG + Intergenic
1176446586 21:6827306-6827328 CCTGCCTTGGAGAAGAAGGAAGG + Intergenic
1176592641 21:8658607-8658629 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1176824756 21:13692336-13692358 CCTGCCTTGGAGAAGAAGGAAGG + Intergenic
1177522808 21:22251424-22251446 CCTTCCCTAGATAAGATCCAAGG - Intergenic
1178496524 21:33090748-33090770 CCTGCCCTGGAGGACATGCAAGG - Intergenic
1180275497 22:10635749-10635771 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1180549985 22:16530726-16530748 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1180977966 22:19860921-19860943 CCTGCCCTGGCTAAGATGGAAGG - Intergenic
1181725069 22:24806002-24806024 CCCGCCCTAGGGAAGAGGGAGGG + Intergenic
1182778683 22:32850345-32850367 CCTGAGCTAGAGAGGATGTTAGG - Intronic
953020604 3:39110655-39110677 CCTGCCCTTGAGATGCTGCAGGG - Intronic
955800501 3:62681207-62681229 CCTGCCCTAGGGCAGAAGGATGG - Intronic
956645931 3:71456154-71456176 CCTTCCCTAGCAAAGATATATGG + Intronic
956665381 3:71637326-71637348 GCTACCCTAAAGAAGATGTGAGG - Intergenic
958042308 3:88241662-88241684 CCTGCCTTTGTGAAAATGTACGG - Intergenic
958429104 3:94017201-94017223 CCTGTAAAAGAGAAGATGTAGGG + Intronic
961310517 3:125996465-125996487 CCTACCCAAGGGAAGCTGTAAGG + Intergenic
962589331 3:136872899-136872921 CCTGCATTTCAGAAGATGTATGG + Intronic
963060629 3:141222048-141222070 CCTGGCCTGGAGAAGAGGGAAGG - Intergenic
964443883 3:156740164-156740186 CCTGCCCAAGACAATAAGTATGG - Intergenic
965644677 3:170868175-170868197 CCTTCCCTAGTGAATATCTAGGG - Intronic
972715458 4:41641503-41641525 CCTGCCTTATAGAAAATGTTTGG + Intronic
977322612 4:95537514-95537536 ACTGTCCTAGAGAATATGTTAGG + Intronic
979711725 4:123787803-123787825 CCTGGACTCAAGAAGATGTAGGG + Intergenic
979909826 4:126349402-126349424 CCTGCCCTAAATAAGTTTTAAGG + Intergenic
981230044 4:142342012-142342034 CCTGGCCCAGAGAAGCTGTGAGG + Intronic
988820821 5:34883092-34883114 AAAGCCCTAGAGAACATGTAAGG - Intronic
989111167 5:37907761-37907783 GCTGCCCTTGAGAAAATGTGGGG - Intergenic
989124385 5:38037374-38037396 CCAGCCCTGGAGGAGATGAAAGG - Intergenic
991492717 5:67198619-67198641 CCTGCCCCAGAGATGTTGAAAGG + Intergenic
992969708 5:82043706-82043728 CGTGCCCTAGAGATTATTTAGGG - Intronic
999960239 5:156747338-156747360 CCTGACCTACAGAAAATGAAAGG - Intronic
1000355705 5:160392498-160392520 ACTCCCCTAGATAATATGTAAGG - Intergenic
1001948801 5:175801553-175801575 CCTGCCATTGAGAAGCTGTGTGG + Intronic
1002495965 5:179611710-179611732 CCTGCCCTAGACTAGCCGTATGG + Intergenic
1009652894 6:66499237-66499259 CCTGCCCTTGAGAAGAGCTGTGG + Intergenic
1017768814 6:157628948-157628970 CCCTCCCTAGAAAAGATGTCTGG + Intronic
1019428313 7:987554-987576 CCTACCCCAGAGGAGATGGAAGG - Intronic
1019644304 7:2120919-2120941 CCTGCCCTAGAGCAGGTGCAGGG - Intronic
1025004751 7:55345015-55345037 CCTGGCCTCGTGGAGATGTATGG - Intergenic
1026847470 7:73705983-73706005 CCTGCCTGAGAGAAGCTGGATGG + Intronic
1029866035 7:103630080-103630102 CTTCCCAGAGAGAAGATGTATGG - Exonic
1030958876 7:115889582-115889604 CCTGCCCTAGAGAGGCAGTCTGG - Intergenic
1031073260 7:117186239-117186261 TATGCCAAAGAGAAGATGTAAGG - Intronic
1032046072 7:128609535-128609557 TCTGACCTAGAGAAGAGGGAGGG + Intergenic
1032746068 7:134787539-134787561 CCTGCCCTAGAGAAGATGTAGGG - Intronic
1035653308 8:1285463-1285485 CCTGTCCTGGAGATGATGGAAGG + Intergenic
1037409473 8:18580917-18580939 ACTGCCCTAGAGATGATTGATGG - Intronic
1038654921 8:29441386-29441408 CCTGATCCAGAGAATATGTAAGG - Intergenic
1040601675 8:48890816-48890838 TCTGCCCTATAGAAGATGGCTGG + Intergenic
1042722154 8:71838044-71838066 CCTGACTTACAGAAGAGGTAAGG + Intronic
1044438549 8:92195089-92195111 CTTGCCATAGAGAAAATTTAAGG - Intergenic
1046563957 8:115874615-115874637 CCTGCCCAAGAGAAAAGGTCTGG - Intergenic
1047331875 8:123896866-123896888 CCTGCCCTAGAATAGCTGCAGGG - Intronic
1049483960 8:142841759-142841781 CCTAACCTGCAGAAGATGTATGG + Intronic
1053692030 9:40591299-40591321 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1054272770 9:63046186-63046208 CCTACCCCAGAGAAGGGGTATGG + Intergenic
1054303287 9:63392265-63392287 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1054402066 9:64718775-64718797 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1054435672 9:65203090-65203112 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1054494721 9:65818597-65818619 CCTACCCCAGAGAAGGGGTATGG + Intergenic
1056309158 9:85321965-85321987 ACTGCCCTGGAGTAGATGCAGGG - Intergenic
1058393113 9:104520077-104520099 CCTACCCAAGGGAAGCTGTAAGG + Intergenic
1058629538 9:106972377-106972399 CCTGCCCATGTGATGATGTAGGG + Intronic
1060204245 9:121673247-121673269 CCAGCCCCAGAGAAGATGGAGGG - Intronic
1061613671 9:131765035-131765057 CCTTCCCTAGACAAGATCTGTGG + Intergenic
1061747948 9:132753722-132753744 CCTTCCCTAGAGAACATGGAGGG - Intronic
1203522604 Un_GL000213v1:57225-57247 CCTGCCTTGGAGAAGAAGGAAGG - Intergenic
1203622693 Un_KI270749v1:137435-137457 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1190799571 X:53775053-53775075 ATTGACCTAGAGAAGATGGAAGG + Intergenic
1191941772 X:66489110-66489132 CCTACCCAAGGGAAGACGTAAGG + Intergenic
1193325677 X:80176617-80176639 CCTGCATTAGAGAACAGGTAGGG - Intergenic
1195095180 X:101494524-101494546 CCTGCCCCAGGGACCATGTACGG - Exonic
1195757019 X:108209069-108209091 TTTGCCCTAGGGAATATGTATGG + Intronic
1201190663 Y:11439843-11439865 CCTACCCCAGAGAAGAGGTATGG - Intergenic