ID: 1032755132

View in Genome Browser
Species Human (GRCh38)
Location 7:134882962-134882984
Sequence GAGTGGTACTATTTGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032755127_1032755132 18 Left 1032755127 7:134882921-134882943 CCAGTAAAGTCGAGCATTTTTAT 0: 1
1: 0
2: 0
3: 10
4: 155
Right 1032755132 7:134882962-134882984 GAGTGGTACTATTTGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032755132 Original CRISPR GAGTGGTACTATTTGGAAGA AGG Intronic
No off target data available for this crispr