ID: 1032755517

View in Genome Browser
Species Human (GRCh38)
Location 7:134887016-134887038
Sequence CTGTCTTATTGCCCTTATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032755517_1032755518 4 Left 1032755517 7:134887016-134887038 CCATTATAAGGGCAATAAGACAG 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1032755518 7:134887043-134887065 ACAACCCAAGCCCCTATTACAGG 0: 1
1: 0
2: 0
3: 4
4: 80
1032755517_1032755524 21 Left 1032755517 7:134887016-134887038 CCATTATAAGGGCAATAAGACAG 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1032755524 7:134887060-134887082 TACAGGCCTAGAGACAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032755517 Original CRISPR CTGTCTTATTGCCCTTATAA TGG (reversed) Intronic
906538405 1:46565327-46565349 CTCTCTTATTTCCCATCTAAGGG + Intronic
907260835 1:53217371-53217393 CTGTCTTATAGCCTTTGAAATGG + Intronic
908998393 1:70187221-70187243 TTATATTATTGCCCTTATAATGG - Intronic
909169388 1:72275436-72275458 CTGTCTTTTTGCTTTTCTAAAGG - Intronic
909997717 1:82301077-82301099 GTGCCTTACTCCCCTTATAAGGG - Intergenic
911713237 1:101098825-101098847 CTGTCCTATTCCACTTAGAAAGG - Intergenic
912434717 1:109653452-109653474 CTGATTTATTGGCCTTGTAATGG - Intergenic
916860508 1:168799378-168799400 CTGTCTTATTGTTGTTATATAGG - Intergenic
918085766 1:181243993-181244015 ATGTCTTTTTGCCCTTAAACTGG + Intergenic
918182603 1:182097362-182097384 CTGTTTCATTCCCCTTATCAAGG + Intergenic
918374094 1:183891411-183891433 CTGTCATATTTCCCTTGTAGAGG + Intronic
919238413 1:194877289-194877311 TTGTCTTGTTGCTCTTATTAGGG + Intergenic
921132442 1:212231375-212231397 CTGTCTTCCTGTTCTTATAAGGG - Intergenic
922135025 1:222815812-222815834 TTGTCTTATTTCCCTTGTCATGG + Intergenic
1063626214 10:7692257-7692279 CTGTCTTATTGCCCTTGCAGAGG + Intergenic
1067513705 10:46917905-46917927 CTTTCTTATTATCCTTTTAATGG + Intronic
1067648548 10:48133929-48133951 CTTTCTTATTATCCTTTTAATGG - Intergenic
1072540633 10:96395665-96395687 CTCTCTTACTGCCCTCAGAAAGG + Intronic
1072828481 10:98632773-98632795 TTGTTTTATTTTCCTTATAAAGG + Intronic
1077641727 11:3887531-3887553 CTGTCTCAATGCCTTTTTAAAGG - Intronic
1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG + Intronic
1079586347 11:22130099-22130121 CTATCCTATTGCCCTCATGATGG + Intergenic
1080781642 11:35435089-35435111 CTGTCTTCTTGCCTGTAAAATGG + Intronic
1084938955 11:72602175-72602197 CTGTCTTCTTGTGCTTGTAAGGG - Intronic
1087855545 11:103087871-103087893 CCATCTTATTTCACTTATAAAGG - Intronic
1088602909 11:111498616-111498638 CACTCTGATTGCCCTTCTAAAGG - Exonic
1089267021 11:117271248-117271270 CTGTCTTCTTGGCCTTGTTAGGG - Intronic
1089780099 11:120867648-120867670 CTCTCTCAGTGCCCTTAGAACGG - Intronic
1090794972 11:130127284-130127306 CTCTCTTATAACCCTTTTAAAGG - Intronic
1091017073 11:132061364-132061386 CTTTCATATTGCAATTATAAAGG + Intronic
1093903463 12:24662201-24662223 CTGTTTTTTTGTTCTTATAAAGG + Intergenic
1094644767 12:32311743-32311765 GTTTCTTATTGCACTTAGAAGGG + Intronic
1098018075 12:66127385-66127407 CTGGCTTATTTCCCTTAGCATGG - Intronic
1099513948 12:83572053-83572075 ATGTCTTAATGCTGTTATAATGG + Intergenic
1099781543 12:87202146-87202168 CTGACTTATTCTTCTTATAAAGG - Intergenic
1100592190 12:96039760-96039782 AAGTCTTTTTGCCCTTTTAAGGG - Intronic
1101235717 12:102787356-102787378 TTGAATTAGTGCCCTTATAAAGG + Intergenic
1102511387 12:113417966-113417988 CTGTCCTCTTGCCCTTGAAAAGG - Intronic
1102812285 12:115834656-115834678 CTGTCTTGTTGCTCCTATAAAGG + Intergenic
1104406620 12:128523130-128523152 CTGTCTTATTTCACTTAGCACGG - Intronic
1107376687 13:39811592-39811614 CTCTCTTATGTCTCTTATAAGGG + Intergenic
1108962617 13:56254810-56254832 ATTCATTATTGCCCTTATAATGG - Intergenic
1110075576 13:71237695-71237717 ATGTGTTATTGCCCTTTAAAGGG + Intergenic
1110308283 13:74016293-74016315 TTGTCTTTTTGCCATTCTAATGG - Intronic
1111593356 13:90378627-90378649 CTGTCTTCTTGCCCTTTGAAAGG - Intergenic
1113374046 13:109747273-109747295 CTGTTTTATTGGCTTTATGAAGG - Intergenic
1113796697 13:113062395-113062417 GTGTGTTATGGCCCTTATGATGG + Intronic
1113796966 13:113064065-113064087 GTGTGTTATGGCCCTTATGATGG - Intronic
1117503496 14:56377262-56377284 CTTCCTTCTTTCCCTTATAAAGG + Intergenic
1117541225 14:56748543-56748565 CTGTCTCATTGCCTTTGTTAAGG + Intergenic
1119181367 14:72607423-72607445 CGGCATTAGTGCCCTTATAAAGG - Intergenic
1119199263 14:72740897-72740919 CTGTCTTATAGCCTTTTAAAAGG - Intronic
1119717010 14:76866759-76866781 CTGCCTTATTGCCCCCAAAAAGG + Intronic
1121920377 14:97875343-97875365 CTGTTTTTTTGCCATTAAAATGG + Intergenic
1121939381 14:98055345-98055367 CTGTCTTATTGTCCTCATTTTGG + Intergenic
1202913799 14_GL000194v1_random:144900-144922 GTTTCTTATTGCCTTTTTAAAGG + Intergenic
1123961303 15:25403862-25403884 CTGTATGATTGCACTTATAGGGG + Intronic
1126159086 15:45593002-45593024 CTCTCCTTTTGCCCTAATAAAGG - Intronic
1127056998 15:55142316-55142338 ATGGATTATTGCCTTTATAAAGG + Intergenic
1127323635 15:57872536-57872558 CTGTTGTATTGCCCTGAAAAGGG - Intergenic
1127686746 15:61353253-61353275 CAGGATTAGTGCCCTTATAAAGG + Intergenic
1129657681 15:77535213-77535235 CTGTATTATTGTCTTTAAAATGG - Intergenic
1132930860 16:2458648-2458670 CTGTCTTTTTGCTACTATAAGGG + Exonic
1133867741 16:9659757-9659779 CTGTCTCATTCCCCTTCTCATGG + Intergenic
1135835112 16:25818274-25818296 CTGGATTAGTGCCCTAATAAAGG + Intronic
1138098841 16:54235411-54235433 CTGTCTTTATGTCCTTATCAGGG - Intergenic
1138297465 16:55899283-55899305 CACTCTCATTGCCATTATAATGG + Intronic
1145889966 17:28407391-28407413 CTGTTTTATTGCCTGTAAAAAGG + Intergenic
1148982918 17:51594721-51594743 CTGTCTTATTGACCTTTTGTAGG + Intergenic
1149129850 17:53285798-53285820 TTGTCTTATTGCTCTGATAAGGG + Intergenic
1155456111 18:26015854-26015876 TTGTCTTATTCTCCTTTTAATGG - Intergenic
1159986229 18:74844497-74844519 CTGTATTATTGATCTAATAATGG + Intronic
1165375200 19:35437042-35437064 CTGCCTTCTGGCCCTTATCAAGG + Intergenic
926120239 2:10237771-10237793 CTGTATTCTTGCCCATAAAATGG - Intergenic
926882500 2:17562508-17562530 CTGTCTTAATGCCATCATTAGGG - Intronic
930083214 2:47471531-47471553 CTGTGTTATTGCCCTTAGAATGG + Intronic
931812664 2:65869628-65869650 CTGACTTCTTTCCCTTATTAAGG - Intergenic
933577737 2:84088951-84088973 CTGTGTTAATTCCCTCATAATGG + Intergenic
934093914 2:88580677-88580699 ATGTCTGATATCCCTTATAAGGG + Intronic
936753091 2:115670136-115670158 CTTTCTTGTTTCTCTTATAAGGG + Intronic
939119576 2:138100425-138100447 TAGGATTATTGCCCTTATAAAGG - Intergenic
940444063 2:153755162-153755184 CTGACTTTTTGATCTTATAAAGG + Intergenic
941766622 2:169304421-169304443 CTGCCCTATTGTCCTCATAAAGG + Intronic
942242720 2:173978213-173978235 CACTCTTATTGACCTCATAATGG - Intergenic
942742313 2:179194745-179194767 CTGTCTTATTTCCCTTAGTTTGG - Intronic
942841512 2:180367211-180367233 CTGTCTTATTCCCTTTAGACTGG - Intergenic
943267159 2:185747062-185747084 CTCTCTTAATGCCCTTATTGTGG + Intronic
944393672 2:199245982-199246004 TTGTCTAATTGCCCTTATGCAGG + Intergenic
945570297 2:211458698-211458720 CTGTGTTATTTCCTTTTTAATGG - Intronic
1168747076 20:252897-252919 CTGTGTGATTACCCTTATATGGG + Intergenic
1168748502 20:265442-265464 CTGTGTTATTGGCCTTGGAAAGG + Intergenic
1169696709 20:8396518-8396540 CTGAATTATTGCCTTAATAAAGG + Intronic
1170114553 20:12843139-12843161 GTGTCTTACTGCCCGTAAAAAGG - Intergenic
1170145657 20:13171092-13171114 CAGTTTTTTTGCCCTTTTAAGGG + Intergenic
1173359108 20:42323835-42323857 TTGTCTGATGGCCGTTATAATGG - Intronic
1176663071 21:9658561-9658583 CTATCCTATTACCCTTCTAAAGG - Intergenic
1176675282 21:9771821-9771843 AGGGCTTATTGCCCTTATAAAGG + Intergenic
1179050080 21:37881700-37881722 CTATCCTATTGCCCTCATGATGG + Intronic
1184396908 22:44247655-44247677 CTGTCTTCTTGTCCATAAAATGG + Exonic
949338106 3:2998818-2998840 CTGTTTTATTTCCATTAAAAAGG - Intronic
949653002 3:6182707-6182729 CTGTGTTAATTCACTTATAATGG - Intergenic
953989133 3:47470473-47470495 CTTTCTTCTTGCCCAGATAAGGG - Intronic
955310578 3:57882589-57882611 ATGGCTAATTTCCCTTATAATGG - Intronic
957312176 3:78534693-78534715 CTTTCTTAATTCCTTTATAATGG + Intergenic
958904944 3:99931514-99931536 CTGTCCTAATGCACTTTTAAAGG - Intronic
959299668 3:104581355-104581377 ATGTCTTATTGCCACTATCATGG + Intergenic
959347132 3:105210984-105211006 TTGTCTTTTTGCTTTTATAATGG + Intergenic
959473304 3:106779672-106779694 CTGACTTATTTCACTTAAAAAGG - Intergenic
959751986 3:109849052-109849074 ATATTTTATTACCCTTATAAAGG - Intergenic
960838338 3:121930492-121930514 CTAATTTATTTCCCTTATAATGG - Intronic
961175689 3:124833412-124833434 TTGTTTTATTTCCCTTCTAATGG + Intronic
962146140 3:132842134-132842156 CTGTCTCTTTGCCCTTTTCAAGG + Intergenic
964129831 3:153274059-153274081 CTATCTTATTTCTCTAATAATGG + Intergenic
964450011 3:156803008-156803030 CTCTCTCATGGCCCTTATAAGGG + Intergenic
970298458 4:14657004-14657026 CTGTCTTTTTCCCCGTAGAATGG - Intergenic
970544804 4:17116496-17116518 CAGGTTTAGTGCCCTTATAAGGG + Intergenic
971490814 4:27210212-27210234 CTGTCTTTTTGCCTTTGGAAAGG - Intergenic
973856974 4:55021313-55021335 TTGTCTTACTGCCTTTTTAATGG - Intergenic
974984567 4:69005619-69005641 CTTTCTTATAGCACTTAAAATGG - Intronic
975266670 4:72377219-72377241 ATGTTTTATTACCCTTAGAAAGG + Intronic
977904740 4:102463304-102463326 CTTTCTTATTTAGCTTATAAAGG + Intergenic
978487726 4:109275271-109275293 CTGTCCTTTTGCCCTGAAAAAGG + Intronic
978960960 4:114678038-114678060 GTGTCTTTTTTCCCTTTTAACGG - Exonic
982989438 4:162252705-162252727 TTGTCTTTTTCCCCTTATAAGGG - Intergenic
983165295 4:164468918-164468940 CTGTATAATTTCCCCTATAATGG + Intergenic
985400268 4:189586876-189586898 AGGGCTTATTGCCCTTATAAAGG - Intergenic
985412250 4:189697482-189697504 CTATCCTATTACCCTTCTAAAGG + Intergenic
987319196 5:16751789-16751811 ATGTCTTGGTGCCCTTTTAAAGG - Intronic
989285445 5:39693615-39693637 ATGTCCTATGGCCCTAATAAAGG + Intergenic
990776622 5:59311774-59311796 CTGGCTTTTTGCCCTGATAATGG - Intronic
991468298 5:66938473-66938495 CTGTCTAATTGGCTTTACAATGG + Intronic
992171640 5:74107718-74107740 CTCTCTTATTGCTCTTCTGAGGG + Intergenic
994183960 5:96798373-96798395 CTCTCTGATTGCACTTAAAAAGG - Intronic
994441781 5:99815889-99815911 CTGTCTTCTTGGGCTTCTAAGGG + Intergenic
1006067890 6:31475484-31475506 CTCTCTGATTCCCCTTTTAATGG + Intergenic
1007762807 6:44143306-44143328 CTGTTTTATAGCCTGTATAAGGG - Intronic
1007804802 6:44434268-44434290 ATGTATTACTGTCCTTATAAAGG + Intronic
1009945529 6:70337680-70337702 CTCTGTTACTGCCCTGATAAGGG + Intergenic
1011262601 6:85484708-85484730 GTGTATTTTTTCCCTTATAAGGG - Intronic
1011686169 6:89825535-89825557 TAGGATTATTGCCCTTATAATGG + Intergenic
1013112201 6:107073114-107073136 CTCCCTTAGTGACCTTATAAAGG + Intronic
1020828958 7:13069000-13069022 CTGTCTTATTGTCATGACAAAGG + Intergenic
1023879585 7:44310706-44310728 CTGTCTGATTCCACTTATATGGG + Intronic
1024980465 7:55153672-55153694 ATGTTTAATTTCCCTTATAAAGG - Intronic
1028146276 7:87323374-87323396 CTGTCTTATTTCCCTCCTCAAGG + Intergenic
1032755517 7:134887016-134887038 CTGTCTTATTGCCCTTATAATGG - Intronic
1037328538 8:17719898-17719920 CTGTCTTATTGCAGTGAAAAGGG + Intronic
1038428123 8:27478471-27478493 CTGTCTTTTAGCCCTTTTAAAGG + Intronic
1040664607 8:49618151-49618173 CTTTCTTATTGGACTTAAAAGGG - Intergenic
1040948399 8:52910003-52910025 CTGTTTTTTTGCCCTTGTATGGG - Intergenic
1042862093 8:73325223-73325245 GTTTGTTATTGCCCTTATAAGGG + Exonic
1044627196 8:94245612-94245634 CTCTCTTCTTTCTCTTATAAAGG + Intergenic
1047491459 8:125378133-125378155 CTGTTTAATTGGCCTTTTAATGG - Intergenic
1048021066 8:130539547-130539569 CTGTCTTATTTTTCTTACAATGG - Intergenic
1049166876 8:141131635-141131657 CTGTTTTATTCCCTTAATAATGG + Intronic
1050344283 9:4670879-4670901 CTGTCCTTTTGCTCTAATAAGGG - Intergenic
1051321475 9:15910069-15910091 CTGAGTTATTTCACTTATAATGG + Intronic
1051729291 9:20122787-20122809 CTGTCTTCTTGCCCTTGTTTTGG + Intergenic
1051807068 9:21006277-21006299 CTCTCTTATGTCTCTTATAATGG - Exonic
1052401482 9:28005783-28005805 CTGTCTTGGTGGCCCTATAAAGG - Intronic
1052602426 9:30652183-30652205 CTGTCATATTAACGTTATAAAGG + Intergenic
1054934680 9:70674014-70674036 CTCTTTTATTGGCCTTATGAGGG + Intronic
1057536653 9:95916205-95916227 TTTTCTTATTGTCTTTATAAAGG + Exonic
1062113146 9:134793317-134793339 CTGTCTTCTTGCCCTTAGGAAGG - Intronic
1203670344 Un_KI270755v1:5499-5521 CTATCCTATTACCCTTCTAAAGG - Intergenic
1186025595 X:5307257-5307279 CTGTTTTATTGAACTTATTAAGG + Intergenic
1187129437 X:16488235-16488257 TGGTATTAGTGCCCTTATAAGGG - Intergenic
1188406486 X:29816905-29816927 CTGTCTTATTACCAAGATAATGG + Intronic
1191885762 X:65886340-65886362 ATATCTAAGTGCCCTTATAAGGG + Intergenic
1193619597 X:83736284-83736306 CTGACTTTTTGCTCTTATAAAGG - Intergenic
1193892826 X:87071989-87072011 CTGTCTCTTTGCCCTTGCAATGG + Intergenic
1195831664 X:109066124-109066146 CTGGCTTATTTCACTTATCATGG + Intergenic
1197165947 X:123377805-123377827 CTGTGTTATTGTCTTTATATTGG + Intronic
1197479225 X:126962312-126962334 CTTTCTTATTGGACTTAAAAGGG - Intergenic
1199803677 X:151275994-151276016 CTGCCTGATTGCCCTGAGAATGG - Intergenic