ID: 1032757665

View in Genome Browser
Species Human (GRCh38)
Location 7:134906330-134906352
Sequence TCACCCGGCCAACCCCAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032757665_1032757669 7 Left 1032757665 7:134906330-134906352 CCACTTTGGGGTTGGCCGGGTGA 0: 1
1: 0
2: 1
3: 7
4: 74
Right 1032757669 7:134906360-134906382 AATGCTGTGTGTATAATCCTGGG No data
1032757665_1032757668 6 Left 1032757665 7:134906330-134906352 CCACTTTGGGGTTGGCCGGGTGA 0: 1
1: 0
2: 1
3: 7
4: 74
Right 1032757668 7:134906359-134906381 AAATGCTGTGTGTATAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032757665 Original CRISPR TCACCCGGCCAACCCCAAAG TGG (reversed) Intronic
900598308 1:3492530-3492552 TGACCCGGCCAACTCCGCAGTGG + Intronic
903137729 1:21320309-21320331 TGACAGGGCCAACCCCACAGAGG + Intronic
903236017 1:21951284-21951306 TCACCTGGTGAACCCCAAGGTGG - Intergenic
904893621 1:33797836-33797858 TCACCCAGCCACCTCCAAAAAGG + Intronic
905523050 1:38614946-38614968 TCACCCCACCATCCCCAAAGAGG + Intergenic
907325380 1:53634755-53634777 TCACACGTCCAACCCCAGAGTGG + Intronic
907383847 1:54112826-54112848 TCACCCTGCCTCCCACAAAGAGG + Intergenic
911620552 1:100063129-100063151 CCAACCGACCAACCCCAAATTGG - Intronic
912941969 1:114053194-114053216 CCACTCTCCCAACCCCAAAGAGG - Intergenic
921933023 1:220770741-220770763 CCACCCAGCCAAGCCCAGAGTGG + Intronic
1067406320 10:46026894-46026916 ACACACTGCTAACCCCAAAGAGG + Intronic
1072343581 10:94480203-94480225 TCTCCCAGCCTTCCCCAAAGGGG - Intronic
1080594000 11:33752117-33752139 GCATCGGGCCAATCCCAAAGTGG + Intronic
1081777389 11:45684949-45684971 TAACCCAGCACACCCCAAAGAGG + Intergenic
1083270114 11:61567899-61567921 TGACCCAGGCAGCCCCAAAGCGG - Intronic
1087131281 11:94671552-94671574 CCACCCAGCCAACTCCAAAGGGG - Intergenic
1089493849 11:118898955-118898977 TGATCCGGCCCACCCCAACGGGG - Exonic
1095327930 12:40920398-40920420 TAACCAGGCCAAACTCAAAGTGG - Intronic
1097573062 12:61356732-61356754 TCACCAGGCCCACCCCACTGAGG - Intergenic
1101739303 12:107487926-107487948 TGACCCAGCCAACCTGAAAGCGG - Intronic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1103173553 12:118843239-118843261 TCACCCTGCCAACTCGGAAGGGG - Intergenic
1104343811 12:127977544-127977566 TCACCTGGCCAGCTCCAGAGTGG - Intergenic
1106656873 13:31755971-31755993 ACACCCGGCTGACCCCAGAGAGG + Intronic
1112222306 13:97503234-97503256 TCACATGGCCAGCCCCACAGAGG - Intergenic
1124782739 15:32651441-32651463 TCACCCCGCCATCCTCAAATGGG - Intronic
1127017845 15:54708490-54708512 CCACCCGGCCAACTCAGAAGGGG + Intergenic
1131749972 15:95495614-95495636 GCAGCCACCCAACCCCAAAGCGG - Intergenic
1163390777 19:17028512-17028534 AGACCAGGCCAACCCCAAACAGG + Intergenic
1166966800 19:46533891-46533913 TCACGCTGCCATCCCCACAGAGG + Intronic
1168706329 19:58472331-58472353 TCACACCTCCATCCCCAAAGAGG + Exonic
928306289 2:30172764-30172786 CCAGCCAGCCAGCCCCAAAGAGG + Intergenic
937453782 2:122024251-122024273 TCACCCAGCCAACCTCAAGCAGG + Intergenic
946383243 2:219363955-219363977 TCCCCAGGCCAGCCCCAAAGGGG - Intergenic
1170145080 20:13164338-13164360 TCACCTGGCCAAGAACAAAGAGG - Intronic
1172392523 20:34575472-34575494 TCAGCCAGCCAAGCCCACAGTGG - Intronic
1172876119 20:38165302-38165324 GCCCCCGGCCCGCCCCAAAGCGG - Exonic
1173001149 20:39106636-39106658 TCACCTGCCAAACACCAAAGTGG - Intergenic
1174073614 20:47916371-47916393 TCATCTGGCCAAAGCCAAAGAGG + Intergenic
1179928553 21:44551774-44551796 TCACCAGGTCAGCCCCAGAGAGG - Intronic
1179940607 21:44637092-44637114 TCACCAGGTCAGCCCCAGAGAGG + Intronic
1179954446 21:44730452-44730474 TCACCCCTCCAACCCCAAAGTGG + Intergenic
1182128731 22:27835141-27835163 TCACCCGGCCAAGAGCACAGGGG + Intergenic
1183478591 22:38050603-38050625 CCCCCCAGCCACCCCCAAAGTGG - Intergenic
1183629340 22:39023867-39023889 TCACCCTGCCACCCCCACTGGGG + Intronic
952016041 3:28958828-28958850 CCACCTGGCCAACCCCGAAGGGG - Intergenic
954637133 3:52077101-52077123 GCACTCAGCCAACCCTAAAGAGG - Intronic
961449585 3:126996483-126996505 TCAAGCTGCCAACCCCACAGTGG - Intronic
961734469 3:128992926-128992948 CCACCTGCCCCACCCCAAAGCGG - Intronic
973613766 4:52659608-52659630 TCCCCCGGCCGACCCCGACGCGG + Intergenic
977385446 4:96333358-96333380 TCTCCCTCCCCACCCCAAAGAGG - Intergenic
987119132 5:14750044-14750066 TCACTAGGCCAACCACAAATTGG - Intronic
990140792 5:52701603-52701625 TCACTCTGCCAACCCCAACCTGG + Intergenic
992839058 5:80668874-80668896 TCACCCTGCCAACTCAGAAGGGG + Intronic
998956434 5:147443473-147443495 TCACCCCCCCAACCCCCAACAGG - Intronic
999804255 5:155067298-155067320 TCACCTGGCCAGTCCCAAAAAGG - Intergenic
1000228691 5:159294889-159294911 TCACACATCCAACCCCACAGTGG + Intergenic
1006021582 6:31120888-31120910 CCACCCACCCAACCCCAATGAGG + Intronic
1007283221 6:40728112-40728134 ACACCTGGCTACCCCCAAAGAGG + Intergenic
1009932634 6:70194304-70194326 TCACCTGGGAAGCCCCAAAGGGG - Intronic
1012142118 6:95636919-95636941 TCACCCTGCCAACTCGAAAGGGG + Intergenic
1014755799 6:125301308-125301330 TCTCCCGGCCACCCCCCAAACGG - Intronic
1021920037 7:25475760-25475782 TCCCCCCTCCATCCCCAAAGGGG - Intergenic
1022519083 7:30994420-30994442 TGCCTCGGCCAGCCCCAAAGAGG + Intergenic
1024912726 7:54464607-54464629 TCACATGGCCAAGCCCAATGCGG + Intergenic
1032757665 7:134906330-134906352 TCACCCGGCCAACCCCAAAGTGG - Intronic
1034143846 7:148850755-148850777 GCCCCCCGCCAACCCCACAGCGG + Intronic
1035299313 7:157887004-157887026 TCACACAGCCAAGCCCACAGCGG + Intronic
1037260581 8:17002586-17002608 TCCCAAGGACAACCCCAAAGAGG - Intergenic
1040110120 8:43563514-43563536 TCACCGGGGGCACCCCAAAGCGG - Intergenic
1043180739 8:77083648-77083670 CCACCCTGCCAACTCCATAGGGG + Intergenic
1052289230 9:26823528-26823550 TAAACTAGCCAACCCCAAAGGGG - Intergenic
1053577170 9:39364580-39364602 TCACCCAGAGAACCCCACAGAGG + Intergenic
1053841672 9:42192505-42192527 TCACCCAGAGAACCCCACAGAGG + Intergenic
1054098741 9:60923270-60923292 TCACCCAGAGAACCCCACAGAGG + Intergenic
1054120141 9:61198899-61198921 TCACCCAGAGAACCCCACAGAGG + Intergenic
1054587615 9:66983663-66983685 TCACCCAGAGAACCCCACAGAGG - Intergenic
1060221364 9:121765748-121765770 CCACCTGGCCAACCCTTAAGTGG - Intronic
1062094499 9:134695879-134695901 TCACCTGTCCCACCCCAATGTGG + Intronic
1186537644 X:10366416-10366438 TCACACGGCCAAACCCAATAGGG - Intergenic
1187871359 X:23767391-23767413 CCACCCGGCCAACTCAGAAGAGG + Intergenic
1189373824 X:40450685-40450707 ACACCCAGCCAACTCCAAATGGG + Intergenic
1201931513 Y:19354643-19354665 TCATCCTGCAAACCCCAAAGTGG - Intergenic