ID: 1032758945

View in Genome Browser
Species Human (GRCh38)
Location 7:134919621-134919643
Sequence CTATGTATGGGGAGATGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 321}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032758938_1032758945 21 Left 1032758938 7:134919577-134919599 CCAAGTATGGTTGGTATGCAAAC 0: 1
1: 0
2: 1
3: 3
4: 68
Right 1032758945 7:134919621-134919643 CTATGTATGGGGAGATGGGGTGG 0: 1
1: 0
2: 1
3: 32
4: 321
1032758937_1032758945 22 Left 1032758937 7:134919576-134919598 CCCAAGTATGGTTGGTATGCAAA 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1032758945 7:134919621-134919643 CTATGTATGGGGAGATGGGGTGG 0: 1
1: 0
2: 1
3: 32
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032758945 Original CRISPR CTATGTATGGGGAGATGGGG TGG Intronic
901457507 1:9371621-9371643 CTATGCCGGGGGAGCTGGGGAGG + Intergenic
904153901 1:28466223-28466245 TTAAGTATGGGGAGGTTGGGAGG + Intronic
904822068 1:33251987-33252009 CAATGGATGGTGAGAAGGGGTGG + Intergenic
904876743 1:33660983-33661005 CTCTGAATGGGGAGATTAGGAGG + Intronic
905970558 1:42138693-42138715 CTGGGTATGGGGAGAGTGGGAGG - Intergenic
906063265 1:42962057-42962079 CTGTGTGTGGGCAGGTGGGGTGG - Intergenic
907210649 1:52818611-52818633 CCTTGTCAGGGGAGATGGGGAGG + Intronic
908412195 1:63878118-63878140 CTAAGTGTGGGCAGATGGTGTGG + Intronic
908966360 1:69768950-69768972 TTATGTTTGGGGATGTGGGGTGG + Intronic
910248740 1:85171376-85171398 GTATGTATGGTGAGAGGAGGTGG + Intronic
910413152 1:86967446-86967468 CTCAGTAGGGGGAGAAGGGGAGG - Intronic
911076438 1:93879888-93879910 CTATGTTTGAGGGGATGGGAAGG + Intronic
915063048 1:153202684-153202706 GGATGGATTGGGAGATGGGGTGG - Intergenic
915932592 1:160069602-160069624 CACTGTATGGGGAGTGGGGGAGG + Intronic
916004123 1:160644253-160644275 CTATGTTTGGGAAGCAGGGGTGG - Intronic
916652607 1:166845454-166845476 CTATGTATGAGGTGCTGTGGAGG + Intronic
916732195 1:167576226-167576248 CTTTGTATGGAAGGATGGGGAGG - Intergenic
917690611 1:177464368-177464390 GTATGTATGAGGAACTGGGGTGG + Intergenic
917789071 1:178487997-178488019 TTATGTATGGGGAGGTGGCTGGG - Intergenic
918315047 1:183316434-183316456 ATGTGTATGGGGAGGTGAGGGGG - Intronic
918445671 1:184614561-184614583 CCATGGATGGGGAGTTGGGTGGG + Intronic
920578203 1:207078829-207078851 GTATGGATGTGGGGATGGGGAGG + Intronic
922501267 1:226098632-226098654 GGAGGTATGGGGAGATGGGGAGG - Intergenic
922699571 1:227750902-227750924 CTGTGTAGAGGGAGATTGGGAGG + Intronic
923769005 1:236920904-236920926 CTATGTATGGGGAAAATGAGAGG + Intergenic
1063808680 10:9678871-9678893 GTATGTGTTGGGGGATGGGGAGG - Intergenic
1065981203 10:30899647-30899669 CTGTGTGTGGGGGGGTGGGGAGG - Intronic
1067227222 10:44384177-44384199 GTGTGTTTGGGGAGCTGGGGAGG + Intronic
1067256478 10:44647467-44647489 GGGAGTATGGGGAGATGGGGTGG - Intergenic
1069636840 10:69930195-69930217 CAAGGGAAGGGGAGATGGGGGGG + Intronic
1070190800 10:74110201-74110223 CTGTGCATGGGGAGTGGGGGAGG + Intronic
1070817534 10:79334767-79334789 GTATGGATGGGGAGATGAGTAGG - Intergenic
1071348115 10:84712759-84712781 ATGTGTATGTGGAGATTGGGTGG - Intergenic
1072205489 10:93201099-93201121 CTGTGTGTGGGTAGATGGGTAGG + Intergenic
1072431732 10:95378463-95378485 CTAGGAATTGGAAGATGGGGTGG - Intronic
1072561137 10:96575451-96575473 CTATAAACGGGGGGATGGGGAGG + Intronic
1073146455 10:101284879-101284901 CTATGTAGGGGAGGATGGGTGGG - Intergenic
1073301311 10:102472750-102472772 CTGAGGATGGGGAGTTGGGGGGG + Intronic
1075158040 10:119996760-119996782 CTATTTCTGGGGAGATAGTGTGG + Intergenic
1078142629 11:8703072-8703094 CTTTGTCTGGGGAGGTGGGCAGG - Intronic
1078161746 11:8846204-8846226 CTATGTCTGGGGAAAGGGAGAGG + Intronic
1079914480 11:26351785-26351807 CTATGTATGGGGAAATGTTTAGG + Intronic
1080528013 11:33146398-33146420 CTATGTATAGCCAGATGTGGTGG + Intronic
1083305541 11:61760375-61760397 CTGTGACTGGGGCGATGGGGAGG + Intronic
1084457318 11:69275513-69275535 GTATGGATGGGTAGATGGGTGGG - Intergenic
1084902619 11:72321166-72321188 CTGTCTTTGAGGAGATGGGGAGG + Intronic
1085881429 11:80471665-80471687 GTGTGTGTGTGGAGATGGGGGGG + Intergenic
1087117487 11:94541364-94541386 ATATGGATGGGGACACGGGGGGG - Intergenic
1088239196 11:107756518-107756540 CCATTTCTGGGGAGTTGGGGAGG + Intergenic
1090475127 11:127013378-127013400 TTATGTTTTGGAAGATGGGGAGG - Intergenic
1090498085 11:127234219-127234241 GTGTGTATGTGGTGATGGGGAGG + Intergenic
1091845767 12:3655314-3655336 CTGTGGATGGGGAAATGGGGAGG + Intronic
1091875314 12:3928929-3928951 CTGTATATGGGGAGGTGGGCAGG - Intergenic
1093017394 12:14168754-14168776 CTTTGTAGGGTAAGATGGGGAGG - Intergenic
1094715195 12:33006849-33006871 CCATGTTTTGGGAGATGGGGGGG + Intergenic
1095644092 12:44521910-44521932 CTAGGTATTGGCAGATGGGGAGG + Intronic
1096613151 12:52816155-52816177 CTAAGTAAGTGGAGAGGGGGTGG + Intergenic
1096850256 12:54430911-54430933 CTCTGTAGGGGGTGATGGGAAGG + Intergenic
1096965593 12:55624822-55624844 CTGTGTATGAGGAGTTGAGGAGG - Intergenic
1099847190 12:88042469-88042491 TTATGTTTGGGGGGAAGGGGTGG + Intronic
1101326817 12:103723055-103723077 CTCAGGATGGGGAGATGAGGTGG + Intronic
1101909404 12:108850479-108850501 CTGGGGGTGGGGAGATGGGGAGG + Intronic
1104899074 12:132178518-132178540 CCATGTAAGGGGAGTGGGGGCGG - Intergenic
1106433752 13:29706167-29706189 CTGTGTGTGGGGAGAAGGGGAGG + Intergenic
1111990133 13:95108275-95108297 CTTTCTATAGGGAGATGGGTGGG + Intronic
1115098598 14:29670692-29670714 ATGTGTATTGGGTGATGGGGAGG - Intronic
1116023486 14:39488666-39488688 CTAAGTATGTGGTGCTGGGGTGG + Intergenic
1122159136 14:99770077-99770099 CTATCTTAGGGGAAATGGGGGGG - Intronic
1122470097 14:101960633-101960655 CCATGAATGTGGGGATGGGGTGG + Intergenic
1122705252 14:103616855-103616877 CTGTGTAAGGGGAGATGGTGAGG + Intronic
1122791397 14:104185563-104185585 GTATGAATAGAGAGATGGGGTGG + Intergenic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124052224 15:26208055-26208077 CTCTGTAGAGGGAGATGGGACGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1126142376 15:45448835-45448857 CTCTAAATGGGGAGGTGGGGAGG - Intergenic
1127607178 15:60598172-60598194 CAATGTAAGGGCTGATGGGGTGG - Intronic
1127781004 15:62315538-62315560 ATATATATGGGGTGAGGGGGAGG + Intergenic
1127784008 15:62340263-62340285 CTATGGATGGGGACTTTGGGAGG - Intergenic
1128244449 15:66123655-66123677 CCAGGGATGGGGAGATGGGGAGG - Intronic
1129825884 15:78634740-78634762 CTGTGGATGGGGACATGGGAAGG + Intronic
1130992540 15:88884707-88884729 CTAAGGATGTCGAGATGGGGAGG + Intronic
1131026996 15:89151724-89151746 CCTTGTATGGGAAGATGGGAAGG + Exonic
1131856203 15:96598477-96598499 CTATGTGAGGGGAGTTGGGGAGG + Intergenic
1134563054 16:15227325-15227347 CTTTGTGTGTGGAGATGGGGAGG - Intergenic
1134923588 16:18138958-18138980 CTTTGTGTGTGGAGATGGGGAGG - Intergenic
1135600814 16:23781902-23781924 GTATGGGTGGGTAGATGGGGGGG + Intergenic
1135712696 16:24730743-24730765 CAATGTATGGGGGGGGGGGGGGG - Intronic
1136272976 16:29159286-29159308 CCATGCATGGTGGGATGGGGGGG + Intergenic
1136593042 16:31229195-31229217 CCATGTGAGGGAAGATGGGGAGG + Intergenic
1137290098 16:47046654-47046676 CTGGGTATGGGGAGATGGGGAGG + Intergenic
1137728225 16:50671080-50671102 ATATGTGTGGGGTGTTGGGGGGG - Intronic
1138099953 16:54244461-54244483 AGCTGTGTGGGGAGATGGGGTGG + Intergenic
1138246313 16:55469439-55469461 CTAGATATGGGGAGATGGAAAGG - Intronic
1139127968 16:64104274-64104296 ATATATATGGACAGATGGGGTGG - Intergenic
1145875733 17:28317393-28317415 CTAGGTAGGGGGAGAGGGAGAGG - Intergenic
1146054532 17:29574513-29574535 CTAAGGATGGGGAGGTGGGGGGG - Exonic
1146054906 17:29576178-29576200 CAAGGTGTGGGGAGATGGGTGGG - Intronic
1146884765 17:36463757-36463779 CTACCTATGGGGTGGTGGGGGGG - Intergenic
1147315920 17:39620183-39620205 CTGTGTAGTGGGAGATGGGTGGG + Intergenic
1147561354 17:41511282-41511304 CTCTCTATGGGGAGAAGGGAGGG + Intergenic
1148006474 17:44435028-44435050 CTATTCATTGGGAGATGGGGAGG - Intronic
1148145256 17:45360678-45360700 CTAGGTGTGGGGAAGTGGGGTGG + Intergenic
1148394646 17:47298469-47298491 GAATGTATGGGTAGATGGGGTGG - Intronic
1149063201 17:52448635-52448657 CTATGTATAGGGAGAGGCAGAGG - Intergenic
1149615207 17:57991640-57991662 GTATTTAAGGGGGGATGGGGGGG - Intronic
1151145233 17:72034405-72034427 CTGTGGATGGGGAGAGGAGGGGG - Intergenic
1151271859 17:73002989-73003011 TTAAGGATGTGGAGATGGGGAGG - Intronic
1151617013 17:75219926-75219948 CTATGTAGGGGTAGGTGGGAGGG + Intronic
1151749235 17:76027296-76027318 CTAAGTCTGGCGAGGTGGGGCGG + Exonic
1151756778 17:76079755-76079777 CTATGCCTGGGGAGGTGGGATGG + Intronic
1155496727 18:26449853-26449875 AAATCTATGGGGAGATGGGGTGG + Intergenic
1155516318 18:26626803-26626825 CTATCCATGGGCAGATGAGGGGG + Intronic
1155670790 18:28368729-28368751 GTATGAATTGGGAGATGTGGAGG + Intergenic
1158409021 18:57187843-57187865 GTGTGTATGGGGAATTGGGGTGG + Intergenic
1161208416 19:3054097-3054119 GTATGTATGGGGACCTGGGCGGG - Intronic
1163633411 19:18428036-18428058 CTGTGGCTGGGGAGGTGGGGTGG + Intronic
1165220807 19:34315242-34315264 CCATGTTTTGGGAAATGGGGTGG + Intronic
1165445643 19:35855640-35855662 GTGTGTATGGGGAGGTGCGGGGG - Intronic
1165871553 19:38976332-38976354 CTATAGCTGGGGGGATGGGGAGG - Intergenic
1166552591 19:43676356-43676378 CTCTGGTTGGGGAGGTGGGGGGG + Intergenic
1167448555 19:49553927-49553949 CTGGGTATGGAGGGATGGGGTGG + Intergenic
1168145275 19:54416742-54416764 CCGTGTGTGGGGAGAGGGGGCGG - Intronic
925774577 2:7322070-7322092 GAGTGTCTGGGGAGATGGGGAGG - Intergenic
926020739 2:9493137-9493159 CTTGGTATGGAGAGATGGTGTGG - Intronic
928901202 2:36319538-36319560 GTATGTATGGTGTGAGGGGGAGG - Intergenic
929094130 2:38247722-38247744 CTCTGTGTGGGCAGCTGGGGTGG - Intergenic
929214749 2:39400170-39400192 CTGTGAATGGAGGGATGGGGAGG - Intronic
933858740 2:86442825-86442847 CCATATATGGAGGGATGGGGTGG + Intronic
934025955 2:88001749-88001771 CTATCTATGGGGTGGAGGGGTGG + Intergenic
936349075 2:111698999-111699021 CCATGGACGGGGAGAAGGGGAGG - Intergenic
936699376 2:114992334-114992356 CTCTGAATGGGGAGCTGGGGTGG - Intronic
936876763 2:117199613-117199635 CAATGAATGGTGAGCTGGGGAGG + Intergenic
937991289 2:127663838-127663860 CTCTGGATGGGGAGGTTGGGAGG - Intronic
938389796 2:130895994-130896016 TTATGTATGGTGTGATGTGGGGG + Intronic
938408165 2:131044213-131044235 CTATGGCTGGGGAGAGGAGGTGG + Intronic
938721575 2:134071731-134071753 CTATTTAGGGGGAGGTGAGGAGG - Intergenic
939255299 2:139736432-139736454 GTGTGTATGTGGAGGTGGGGAGG - Intergenic
940004556 2:148998940-148998962 ATGTGTAGGGGGAGAAGGGGAGG - Intronic
940857536 2:158741219-158741241 CTTTATAGTGGGAGATGGGGAGG + Intergenic
943661308 2:190562308-190562330 ATATCTATGGGCAGATGGGAGGG - Intergenic
943982846 2:194577168-194577190 CTATTTTTGGGGGGGTGGGGGGG - Intergenic
944192144 2:197014895-197014917 CTGTGTGTGGAGAGGTGGGGTGG - Intronic
944540352 2:200748452-200748474 GCATGTATGTGGAGGTGGGGTGG - Intergenic
946916896 2:224532292-224532314 CTATTTAAGGGGGGATGGTGGGG + Intronic
1169431878 20:5543689-5543711 AAATGTATGTGGAGATGAGGAGG - Intergenic
1170213432 20:13868197-13868219 CTAAGTATGGGGGAATGGGATGG - Intronic
1171175788 20:23050080-23050102 CTTTGAATGGGGAGTGGGGGAGG + Intergenic
1171255540 20:23686733-23686755 CTATGTGTGTGCAGATGGGGTGG - Intronic
1171262877 20:23748661-23748683 CCATGTATGTGCAGATGGGGTGG - Intronic
1171272008 20:23824865-23824887 CTATGTGTGTGCAGATGGGGTGG - Intronic
1171278354 20:23877040-23877062 CTATGTGTGTGCAGATGGAGTGG - Intronic
1171283438 20:23919594-23919616 CTATGTGTGTGCAGATGAGGTGG - Intergenic
1173817919 20:46001829-46001851 CAGGGTCTGGGGAGATGGGGAGG - Intergenic
1174068485 20:47883184-47883206 CCATGGATGGAGAGCTGGGGAGG + Intergenic
1174230144 20:49039720-49039742 TCATTGATGGGGAGATGGGGAGG - Intergenic
1174291442 20:49511854-49511876 GGATGGATGGGTAGATGGGGTGG + Intronic
1175219484 20:57408825-57408847 CAGTGTTTGGGGAGTTGGGGAGG - Exonic
1178511453 21:33208054-33208076 ATATCTATGGAGAGATGGGGTGG - Intergenic
1179030938 21:37718963-37718985 GCATCCATGGGGAGATGGGGAGG + Intronic
1179236297 21:39549744-39549766 ATATGTTTGAGGAGATGGGTGGG + Intergenic
1180011511 21:45054418-45054440 GTATCCATGGGGACATGGGGAGG + Intergenic
1181025386 22:20124602-20124624 CTGTGCCTGGGGAGTTGGGGTGG + Intronic
1181095688 22:20503833-20503855 TTATGTATGTGGAGGTAGGGAGG - Intronic
1181992329 22:26846993-26847015 CTGGATGTGGGGAGATGGGGAGG - Intergenic
1183301690 22:37061927-37061949 CTATTTCTGTGGGGATGGGGAGG + Intronic
1183960177 22:41406717-41406739 CTCTGTATGGGGAAGAGGGGAGG - Intergenic
949243050 3:1893804-1893826 GTATGTATGGGTTGGTGGGGGGG + Intergenic
949360280 3:3224391-3224413 CTATCTATATGGAGAGGGGGAGG - Intergenic
950196431 3:11012346-11012368 CTATGTGGGTGGAGCTGGGGTGG - Intronic
950419105 3:12886454-12886476 CTGTGTATGGGGTGGTGGGGGGG - Intergenic
951087628 3:18532473-18532495 CTAAGTATGGGGTTATGGGTGGG + Intergenic
952899993 3:38104459-38104481 CTTTTTTTGGGGGGATGGGGTGG - Intronic
953330017 3:42044687-42044709 ATCTGCATGGGGAGAAGGGGAGG + Intronic
954450834 3:50570863-50570885 CAATGTATTGGTAGAAGGGGGGG + Intronic
959954999 3:112226720-112226742 TTGTGTGTGGGGGGATGGGGGGG - Intronic
960242593 3:115363158-115363180 ATATTTATGAGGAAATGGGGAGG - Intergenic
960303083 3:116027967-116027989 CTGTGTATGTGGTGATGGTGGGG + Intronic
961552188 3:127675879-127675901 CCATGTGTGGGAAGGTGGGGAGG + Intronic
961613743 3:128162449-128162471 CAGTGTATGGGGAGATCAGGTGG - Intronic
961831456 3:129625179-129625201 CTGTGTTTTGGGAGATGGGGTGG - Intergenic
963776814 3:149448264-149448286 CTCGGGATGGGGAGATGGGTAGG - Intergenic
965940063 3:174168886-174168908 CTCTGCATGGGGATAGGGGGTGG + Intronic
967854593 3:194107119-194107141 CACTGTATTGGGAGAGGGGGTGG - Intergenic
967891301 3:194366186-194366208 GGATGTTTGGTGAGATGGGGAGG - Intronic
968924831 4:3541687-3541709 GGATGGATGGGTAGATGGGGTGG + Intergenic
968924838 4:3541712-3541734 AGATGGATGGGTAGATGGGGTGG + Intergenic
970982147 4:22111438-22111460 AGAGGAATGGGGAGATGGGGTGG + Intergenic
971214324 4:24649463-24649485 ATGTGTTTGTGGAGATGGGGTGG + Intergenic
972985226 4:44755214-44755236 CTAAGGGTGTGGAGATGGGGAGG - Intergenic
973062237 4:45741975-45741997 CTATATATGGGGAATTGAGGAGG + Intergenic
976674591 4:87690556-87690578 CCATGGATGGGGTGAGGGGGTGG - Intergenic
977558980 4:98513319-98513341 CTATGTGTGGTGAGCAGGGGTGG + Intronic
978112892 4:104984348-104984370 CTATGTAGGGGGCCAGGGGGAGG + Intergenic
978519642 4:109603088-109603110 CTATGGAGAGGGAGATGGAGAGG - Intronic
978535776 4:109760869-109760891 CTATATTTGCTGAGATGGGGAGG + Intronic
978710665 4:111776794-111776816 CTAAGTGTGGGGGGCTGGGGAGG - Intergenic
978929825 4:114296482-114296504 CTGTTTGTGGGGAGGTGGGGAGG - Intergenic
979431690 4:120640056-120640078 CTATGGAGGGAGAGATGGGCAGG - Intergenic
980128578 4:128797419-128797441 CTTTGCATGGGGGGATGGGAAGG - Intergenic
983059654 4:163143521-163143543 GTATGTGTGTGGAGAGGGGGAGG - Intronic
985662836 5:1165950-1165972 GGATGGATGGGGAGATGGGTGGG - Intergenic
985767460 5:1787501-1787523 CTCTGTGTGGGGAGGTGGCGGGG - Intergenic
985788303 5:1911394-1911416 CTATGGATGGGGAGGCAGGGTGG - Intergenic
987297102 5:16562972-16562994 CTATTAATGGGGGGATGGGGGGG + Intronic
988499987 5:31776419-31776441 CAATGTATGGGGAGTAGGGTAGG - Intronic
990462959 5:56046783-56046805 GTATATATGGTGAGAAGGGGAGG - Intergenic
992864673 5:80945835-80945857 GTTTGCATGGGGTGATGGGGGGG + Intergenic
993901514 5:93587303-93587325 CTTTGTATGGGGCGACGGGGAGG + Intronic
994213247 5:97109080-97109102 CTAGGTTTGTGGAGATGGGGAGG - Intronic
995645477 5:114306449-114306471 CTATGTAATTGGAGGTGGGGTGG + Intergenic
996991394 5:129636609-129636631 CTATGTATGTGGAGTGGAGGAGG + Intronic
997549584 5:134740055-134740077 TTGTGTGTGTGGAGATGGGGGGG + Intronic
998262514 5:140642244-140642266 CTGCGTGTGGGGAGATGGGGAGG - Intronic
999178132 5:149646639-149646661 CTTTGGCTGGGGAGATGTGGTGG - Intergenic
1000966404 5:167662239-167662261 TTGGGTATGGGGAGTTGGGGTGG + Intronic
1001233315 5:170008684-170008706 CTAGGTATGGGGACATGAGACGG + Exonic
1001388557 5:171359861-171359883 CCGTGTCTGGGGACATGGGGCGG + Intergenic
1001762893 5:174222489-174222511 CCATGTATGGGGTGAGGGTGGGG + Intronic
1003057173 6:2832464-2832486 GGCTGTGTGGGGAGATGGGGTGG - Exonic
1003650205 6:7952281-7952303 CCATGTAAGGGCAGACGGGGTGG - Intronic
1003847250 6:10185920-10185942 CAAAGGATGGGGAGATGGGCAGG - Intronic
1004238165 6:13894078-13894100 CTGTGTTTGGGGACATGGAGAGG - Intergenic
1005856064 6:29864116-29864138 CGGTGTAGGGGGAGCTGGGGAGG - Intergenic
1006047372 6:31308769-31308791 CTGTGTGGGGGGAGCTGGGGAGG + Intronic
1006094134 6:31645130-31645152 CTCTGCATTGGGAGTTGGGGGGG + Exonic
1006104930 6:31710733-31710755 CTGTGTATGGGGAGGGGTGGGGG + Intronic
1006299833 6:33187828-33187850 GTGTGCATGGGTAGATGGGGAGG + Intronic
1006333627 6:33409763-33409785 CTATGTATCGGGTGAGGGGTGGG + Exonic
1006396483 6:33790550-33790572 CTAAGTCAGGGGAGATGGGGAGG - Intergenic
1006692272 6:35899282-35899304 ATATGTATAGAGAGATGGGTTGG - Intronic
1008743084 6:54633781-54633803 CTAGGTATGACGAAATGGGGAGG - Intergenic
1009458048 6:63879543-63879565 ATGTGTATGGGGACATGGTGTGG + Intronic
1011673114 6:89703356-89703378 CCATGTATGGGGAAGGGGGGGGG + Intronic
1013700353 6:112761077-112761099 CTAAGACTGGGGAGGTGGGGGGG - Intergenic
1014269867 6:119324859-119324881 CTGTGTTTGGGGGGTTGGGGAGG + Intronic
1014283495 6:119467520-119467542 GTATGTATTGGGAGAGGGAGTGG + Intergenic
1015052939 6:128863718-128863740 CTCTGCAGGGAGAGATGGGGAGG + Intergenic
1015456785 6:133435462-133435484 CTGTGTCTGGGGAAATGGGTTGG + Intronic
1018144071 6:160866576-160866598 CTAGGGGTGGGGAAATGGGGAGG - Intergenic
1018628581 6:165803914-165803936 CTGGGGTTGGGGAGATGGGGAGG - Intronic
1019101534 6:169634843-169634865 ATATGTAGCGGGAGATGGGCAGG - Intronic
1019160566 6:170065476-170065498 GGATGGATGGGGGGATGGGGTGG - Intergenic
1019941086 7:4291761-4291783 CAATGTAGTGGGAGATGGAGAGG + Intergenic
1020382092 7:7557726-7557748 CACTGTATGGGGGGTTGGGGTGG - Intergenic
1021926705 7:25540801-25540823 CTAGCCATGGGGAGATGGGGAGG + Intergenic
1022589735 7:31650295-31650317 CTTTTTATTGGGGGATGGGGAGG + Intronic
1022902986 7:34828501-34828523 CTCTGCATGTGTAGATGGGGTGG + Intronic
1023079170 7:36511691-36511713 CCAGGAATGGGGAGATGGGGAGG + Intergenic
1025827008 7:65018763-65018785 CTATGTATAAGGAAATGGGAGGG + Intergenic
1026432140 7:70358049-70358071 CTATGGATGAGCAGATGGGTGGG + Intronic
1026601822 7:71783779-71783801 CTATGAATGGGAAGTTGGGAGGG + Exonic
1027545685 7:79524769-79524791 CTATGTATATGGATATGTGGGGG + Intergenic
1029483087 7:100824542-100824564 AAATGTACGGGGAGAAGGGGCGG + Intronic
1029489284 7:100861581-100861603 CCAGGTATGGGGAGCTGGTGGGG + Exonic
1030395538 7:108981579-108981601 CTGTGTATGTGGAGGTGGGGTGG + Intergenic
1030911800 7:115259346-115259368 TTATGAATTGGGAGCTGGGGTGG + Intergenic
1030928052 7:115481925-115481947 CTATGGATGGGTAAAGGGGGTGG - Intergenic
1032251865 7:130264648-130264670 CAATGGATGGGGAGATGTTGTGG + Intergenic
1032570567 7:132991869-132991891 CCATGTAGGGGAAGATGGAGAGG - Intronic
1032758945 7:134919621-134919643 CTATGTATGGGGAGATGGGGTGG + Intronic
1032871687 7:135992512-135992534 CTATCTATGGGGAGATAAGTGGG - Intergenic
1034461027 7:151198176-151198198 GGATGGATGGGGAGATGGAGAGG + Intronic
1035218002 7:157384611-157384633 CTCTGCATGAGGAGAGGGGGAGG + Intronic
1035267053 7:157695870-157695892 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267061 7:157695909-157695931 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267067 7:157695948-157695970 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267075 7:157695987-157696009 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267083 7:157696026-157696048 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267091 7:157696065-157696087 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267099 7:157696104-157696126 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267107 7:157696143-157696165 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267124 7:157696221-157696243 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267130 7:157696260-157696282 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267136 7:157696299-157696321 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267147 7:157696377-157696399 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267154 7:157696416-157696438 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267160 7:157696455-157696477 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267167 7:157696494-157696516 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267175 7:157696533-157696555 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267181 7:157696572-157696594 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267187 7:157696611-157696633 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267214 7:157696767-157696789 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267255 7:157697001-157697023 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267262 7:157697040-157697062 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267270 7:157697079-157697101 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267278 7:157697118-157697140 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267286 7:157697157-157697179 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267294 7:157697196-157697218 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267302 7:157697235-157697257 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267307 7:157697274-157697296 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267315 7:157697313-157697335 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267321 7:157697352-157697374 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267328 7:157697391-157697413 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267334 7:157697430-157697452 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267345 7:157697508-157697530 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267352 7:157697547-157697569 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267360 7:157697586-157697608 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267395 7:157697781-157697803 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267420 7:157697937-157697959 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267426 7:157697976-157697998 GTATGCATGGGTAGATGGTGAGG - Intronic
1035267434 7:157698015-157698037 GTATGCATGGGTAGATGGTGAGG - Intronic
1037622508 8:20577178-20577200 CTAGGTAGGGGGTGACGGGGAGG + Intergenic
1038130138 8:24720828-24720850 TTATGAGTGGTGAGATGGGGAGG - Intergenic
1041535795 8:58924321-58924343 GTATGTATGGAGAGAGGGGATGG - Intronic
1041669024 8:60474757-60474779 CTATGGATGGGCAGAAGTGGTGG - Intergenic
1043401595 8:79890652-79890674 GTGTGTTTGGGGAGGTGGGGTGG - Intergenic
1044531312 8:93310620-93310642 CTAGGGATCGTGAGATGGGGAGG + Intergenic
1045214898 8:100138613-100138635 GTATGTTTGGAGAGATGGGAAGG + Intronic
1048070288 8:131013573-131013595 CTATGGAGGAGGAGATGGTGGGG - Intronic
1048573654 8:135674577-135674599 CCATGCAAGGGGTGATGGGGAGG + Intergenic
1048979797 8:139697150-139697172 GAATGTATGGGTAGATGGGTGGG + Intronic
1049327863 8:142033159-142033181 CCATGTTTGGGGTGAGGGGGCGG + Intergenic
1052044113 9:23774656-23774678 ATTTTTATGGGGAGTTGGGGAGG - Intronic
1053789550 9:41677104-41677126 CTATGTAGGGGGAGGCTGGGAGG - Intergenic
1053799877 9:41757560-41757582 GGATGGATGGGTAGATGGGGTGG + Intergenic
1054155593 9:61637648-61637670 CTATGTAGGGGGAGGCTGGGAGG + Intergenic
1054177888 9:61888795-61888817 CTATGTAGGGGGAGGCTGGGAGG - Intergenic
1054188309 9:61969708-61969730 GGATGGATGGGTAGATGGGGTGG + Intergenic
1054464984 9:65488103-65488125 AGATGGATGGGTAGATGGGGTGG - Intergenic
1054464991 9:65488128-65488150 GGATGGATGGGTAGATGGGGTGG - Intergenic
1054465058 9:65488399-65488421 AGATGAATGGGTAGATGGGGTGG - Intergenic
1054465064 9:65488424-65488446 GGATGGATGGGTAGATGGGGTGG - Intergenic
1054475362 9:65568658-65568680 CTATGTAGGGGGAGGCTGGGAGG + Intergenic
1054659641 9:67692029-67692051 CTATGTAGGGGGAGGCTGGGAGG + Intergenic
1055729647 9:79267341-79267363 TTAGTTATGGGGAGTTGGGGAGG + Intergenic
1056274492 9:84980701-84980723 CTTTGTATGGGATGATGGGTAGG - Intronic
1056505746 9:87256772-87256794 CACTGAATGGAGAGATGGGGTGG - Intergenic
1056874948 9:90319184-90319206 CTATGTAGGGAGAGGTGAGGAGG + Intergenic
1057421092 9:94913056-94913078 CTAGGAATGGGGACATGGGCAGG + Intronic
1057995965 9:99821943-99821965 CTGTGTATGGGGAGCGGAGGAGG - Exonic
1058878312 9:109263786-109263808 CTATATAATGGGAGATGGGTCGG - Intronic
1061829074 9:133279159-133279181 CTATGGATGGGGAGAGGTGGGGG + Intergenic
1203363132 Un_KI270442v1:235349-235371 GTGTGTATGGGGAGGTGGTGTGG - Intergenic
1186474390 X:9845905-9845927 CTATATTTGGGGGGTTGGGGAGG - Intronic
1186540535 X:10395727-10395749 CAAGCTGTGGGGAGATGGGGAGG - Intergenic
1187767687 X:22661354-22661376 CTATGTCTGGGGAGATTGGATGG - Intergenic
1190951208 X:55145023-55145045 CTATTTATTTAGAGATGGGGGGG - Intronic
1190970418 X:55342652-55342674 CGGTGTAGGGGGAGAGGGGGAGG - Intergenic
1192243783 X:69357005-69357027 CTATGCATGAGGAGAGGGGAGGG + Intergenic
1192585636 X:72316383-72316405 CAATGGGTGGGGGGATGGGGTGG + Intergenic
1193834807 X:86329052-86329074 CTGTGTATGTGCGGATGGGGAGG + Intronic
1194247163 X:91529705-91529727 CTATATATGGGGAGAGAGAGGGG + Intergenic
1195050927 X:101096223-101096245 CCAGGGATGGGGAAATGGGGGGG + Exonic
1195906905 X:109852967-109852989 CTGTGTGTGGGGAGATGCGGGGG - Intergenic
1198081880 X:133247749-133247771 CTAAATATGGGGTGATAGGGTGG + Intergenic
1199029981 X:142986265-142986287 CTAGGTATGGAGAAATGGAGTGG + Intergenic
1199617858 X:149671926-149671948 CTTAATATGGGGAGATGGAGAGG - Intergenic
1199624784 X:149731323-149731345 CTTAATATGGGGAGATGGAGAGG + Intergenic
1200085408 X:153601869-153601891 CAATGTATGGGCACATGGTGAGG - Intergenic
1200205379 X:154311885-154311907 CTATGTGTGGGCATATGAGGGGG - Intronic
1200409430 Y:2846857-2846879 TTAAGTAGGGGGAGATGGAGTGG + Intronic
1200566185 Y:4771243-4771265 CTATATATGGGGAGAGAGAGGGG + Intergenic
1201311771 Y:12604023-12604045 CTATTTATGGGTAGTTGCGGTGG - Intergenic