ID: 1032761069

View in Genome Browser
Species Human (GRCh38)
Location 7:134942329-134942351
Sequence ATATTTCAGTCTCATCCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032761063_1032761069 18 Left 1032761063 7:134942288-134942310 CCTTTGTAATATTCAAAAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 232
Right 1032761069 7:134942329-134942351 ATATTTCAGTCTCATCCAAGAGG 0: 1
1: 0
2: 0
3: 13
4: 155
1032761062_1032761069 24 Left 1032761062 7:134942282-134942304 CCAAAGCCTTTGTAATATTCAAA 0: 1
1: 0
2: 0
3: 17
4: 328
Right 1032761069 7:134942329-134942351 ATATTTCAGTCTCATCCAAGAGG 0: 1
1: 0
2: 0
3: 13
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032761069 Original CRISPR ATATTTCAGTCTCATCCAAG AGG Intronic
903039277 1:20516388-20516410 ATATTTCCTTATCTTCCAAGTGG - Intergenic
904782297 1:32959582-32959604 TCATTTTAGTCTCATCCAGGTGG - Intronic
906052848 1:42888686-42888708 GCATTTCAGTCTCATCGTAGGGG + Intergenic
908327925 1:63042128-63042150 ATATTTTAGTTTCATTAAAGAGG + Intergenic
909361888 1:74769560-74769582 ATATGTCAGTCACATGCAACAGG + Intergenic
910894391 1:92052690-92052712 ATATTTCAGTCTGATCCTACAGG + Intronic
911550626 1:99275343-99275365 ATATTTCAGTCTCAGACTAATGG + Intronic
911998616 1:104800155-104800177 ATAATTCAGTCTCAGTCAAACGG + Intergenic
916989767 1:170230043-170230065 ATATTTTAGTCTCTGCCAATTGG - Intergenic
918678083 1:187315225-187315247 GTCTTTCAGTCTCATCCATTTGG + Intergenic
919071417 1:192760414-192760436 ATATATTAGTTTCATCAAAGGGG + Intergenic
921279056 1:213547646-213547668 AGATTTCACTCTCAACCAAGAGG - Intergenic
921430268 1:215057448-215057470 ATATTTCACTGTCACCCATGTGG - Intronic
921546853 1:216483549-216483571 ATAATGCAGTCTCATTAAAGAGG + Intergenic
924725286 1:246663869-246663891 ATATTTCCTTCCCATCCCAGAGG - Intronic
1063061460 10:2559036-2559058 ATAGTTCTGTATCATCCAGGTGG + Intergenic
1063421821 10:5918353-5918375 ATAGTTCTGTCTCAGCCATGTGG + Exonic
1063638726 10:7810717-7810739 AGAGCTCAGACTCATCCAAGAGG - Intergenic
1064118537 10:12599493-12599515 TTATGTCTGTCTCATCCCAGAGG - Intronic
1065061991 10:21911553-21911575 ATATTACAGTCTCAGACCAGAGG - Intronic
1069285213 10:66705846-66705868 ATATTTCTGTTTCAAACAAGAGG - Intronic
1073679121 10:105683029-105683051 ACCTTTCTGTCTCATCTAAGGGG - Intergenic
1079937780 11:26639135-26639157 CTATTTCAGTGTCATCCTAGTGG + Exonic
1081465157 11:43309503-43309525 ATATTTCAGGCTCCTCAAAATGG + Intergenic
1082243998 11:49899407-49899429 ATATTTTAGTTTCAGCCAAAAGG + Intergenic
1083012730 11:59419199-59419221 ACATATCAGTCTCAGCCAACAGG - Intergenic
1083021476 11:59511965-59511987 AAATTTCATTCCCAGCCAAGAGG - Intergenic
1083280282 11:61622592-61622614 CTGTTTCTGTCTCAGCCAAGGGG + Intergenic
1083427884 11:62598350-62598372 AGATATCTGTCTCATTCAAGAGG + Exonic
1088184813 11:107154711-107154733 ATCTTTCAGTCACATTCATGTGG + Intergenic
1088710417 11:112503403-112503425 ATATTTCTGTCCCACCTAAGGGG - Intergenic
1088763834 11:112957923-112957945 ATGTTTCAGAGACATCCAAGTGG - Intergenic
1089020651 11:115211047-115211069 AAATCTCATTCTCCTCCAAGAGG + Intronic
1090087237 11:123661680-123661702 ATAATTCAATCACATCCAACTGG + Intergenic
1092920987 12:13231796-13231818 ATAGGTCAGCCTTATCCAAGTGG - Intergenic
1094098661 12:26737062-26737084 AAATTTCAGTTCCATGCAAGGGG + Intronic
1094354689 12:29565302-29565324 AAATGTTAATCTCATCCAAGAGG + Intronic
1095197226 12:39334435-39334457 ATATTTCTGTCTCATCAGATGGG + Intronic
1097430758 12:59503126-59503148 ATATTTCAGACTGATGGAAGGGG - Intergenic
1098431946 12:70429320-70429342 ATATTTCCGTTTCATCCACAAGG - Intronic
1098522939 12:71454100-71454122 ATAATACAGGCTCATCCAATAGG - Intronic
1098660861 12:73092390-73092412 ATATTTCACTCTCTTCCATTTGG + Intergenic
1099011257 12:77294059-77294081 ATAACTCAGTCACATGCAAGGGG - Intergenic
1099786973 12:87277524-87277546 ATATCTCAGATTTATCCAAGTGG - Intergenic
1102518914 12:113467286-113467308 ACATCTCAGACTCGTCCAAGCGG + Exonic
1110076056 13:71244710-71244732 AGGTTTCAGTCAAATCCAAGTGG + Intergenic
1110357529 13:74585223-74585245 ATATTTCAGACACATACAAATGG + Intergenic
1111101384 13:83592625-83592647 ATTTTTCACTCTCATCGAAATGG - Intergenic
1111386038 13:87529004-87529026 ATATTTAAGTCTTTTGCAAGGGG + Intergenic
1111552307 13:89830126-89830148 GTATTTAAGTCTCATCAAATTGG + Intergenic
1112920718 13:104608981-104609003 ATATTTCAGTGTAAAACAAGAGG + Intergenic
1114424072 14:22607806-22607828 ATAATTCATTCACATCCCAGAGG + Intronic
1121613249 14:95295246-95295268 TTAGTTCAGTCTAATCGAAGAGG + Intronic
1121976662 14:98410801-98410823 AAACTTCAGTCTCACCAAAGAGG - Intergenic
1122159844 14:99774829-99774851 AACTTTCATTCTCATTCAAGAGG - Intronic
1124859848 15:33428597-33428619 TTTTTTCTGTCTCCTCCAAGAGG + Intronic
1125740342 15:41958399-41958421 CCAGTTCAGACTCATCCAAGTGG + Intronic
1127791281 15:62400778-62400800 TTATTTCAGTGTCAGCAAAGGGG + Intronic
1128337847 15:66798885-66798907 ATTTTGCAGTCTCATCCATCTGG - Intergenic
1129951319 15:79594074-79594096 ATCTTTTATTCTCATCCACGTGG - Intergenic
1133585569 16:7191053-7191075 ATATCACACTCACATCCAAGGGG - Intronic
1133649406 16:7797033-7797055 TTCTTTCAGTCTCAGCAAAGGGG - Intergenic
1133687781 16:8182624-8182646 ATATTTCACTCTCCTCTGAGGGG - Intergenic
1137947468 16:52747938-52747960 ATAATAAAGTCTCATCCTAGAGG - Intergenic
1138935127 16:61710310-61710332 AGATTTCTGTCTCAACCGAGTGG - Intronic
1144185521 17:12791653-12791675 ATTTTTCAGCCTCATCCATGGGG + Intronic
1144451451 17:15383203-15383225 ATATTGCAGACTCAGCCAAAAGG + Intergenic
1149688870 17:58556492-58556514 ATATGGCACTCTCAGCCAAGTGG + Intergenic
1150581815 17:66481181-66481203 ACATTTCAGGATCATACAAGTGG - Intronic
1151380597 17:73723144-73723166 ATCTGTCAGTCTCGTCCCAGAGG - Intergenic
1151802475 17:76386094-76386116 AGATTTCAGCCTCAGCCAAAAGG - Exonic
1153126912 18:1804258-1804280 CTATTTCATTCTCATCCAACTGG - Intergenic
1155368076 18:25068941-25068963 ATATGTCAGTCTGATCCCGGAGG - Intronic
1155583100 18:27334358-27334380 AGATTTCATTCTCTTTCAAGTGG + Intergenic
1158876836 18:61742356-61742378 ATATTTGAGTGTCCTCCATGAGG + Intergenic
1159796376 18:72849146-72849168 CTTTTCCAATCTCATCCAAGGGG + Intronic
1159980478 18:74773097-74773119 ATATTTTAGTGTCATCCACAAGG + Intronic
928266190 2:29813955-29813977 ATATTTCAGTAACATCCGAGAGG + Intronic
928764114 2:34621474-34621496 ATATTTAAGTCTAATCAAACTGG - Intergenic
929563640 2:42970950-42970972 ACTTCTCAGTATCATCCAAGGGG - Intergenic
932045492 2:68344871-68344893 ATACTTCAGTCTCATGCATAGGG - Intergenic
936727318 2:115335206-115335228 ATATTTCAGTCACCTCCCACTGG + Intronic
937048531 2:118868217-118868239 ATATTTCAGCCTCAAGGAAGAGG + Intergenic
937421329 2:121758153-121758175 ATATTTTATTTTCATTCAAGAGG - Intronic
939381065 2:141436914-141436936 ATATATTATTCTCATCCAAAAGG - Intronic
939695078 2:145313423-145313445 ATAATTCAGTCACATCCCACTGG + Intergenic
940915199 2:159246916-159246938 AAATTTTAGTTTCATCCATGAGG - Intronic
941428321 2:165379275-165379297 ATTTTTAAGGCTCATCCATGTGG - Intronic
942168623 2:173267138-173267160 ATATTGCAGCCTCAGCCAAAAGG - Exonic
942280096 2:174353268-174353290 ATATTTCATTTTAAACCAAGAGG + Intronic
944453333 2:199866872-199866894 ATATTTCACGCACATTCAAGGGG + Intergenic
945069307 2:205974945-205974967 ATGATTCAATCTGATCCAAGAGG + Intergenic
946818787 2:223609147-223609169 ATATTTCAGCCCAATACAAGGGG - Intergenic
946898419 2:224348614-224348636 ATCTTTCTGTATCATACAAGAGG - Intergenic
948163880 2:235845987-235846009 AAATTTAAGCCTCATCCAGGAGG - Intronic
948361500 2:237423852-237423874 AAATTACAGGCTCATCCAGGAGG + Intronic
1177377478 21:20292174-20292196 ACGTTTCAGTCTCATCTAGGGGG - Intergenic
1177687631 21:24459611-24459633 ATATTTTAGTATCATGTAAGGGG + Intergenic
1179185675 21:39083579-39083601 ATAATTCAGTCTCATGCAGCAGG - Intergenic
1179342466 21:40525792-40525814 TCATTTCAGTCTCAGCCAAGAGG + Intronic
1184976822 22:48068126-48068148 ATATTTCAGTGTGATTCTAGGGG - Intergenic
1185199979 22:49495440-49495462 TAATTTCCGTCTCATCCAGGAGG + Intronic
949204209 3:1418715-1418737 ACATTTCAGTATCATCCACCTGG - Intergenic
950514734 3:13457290-13457312 GTATTTAAGTTTCATCCATGTGG - Intergenic
956723709 3:72139741-72139763 ATATTCTAGACTCATCCCAGAGG - Intergenic
958682574 3:97350905-97350927 ATATTTCAATTTCATCCCACAGG - Intronic
959369588 3:105506398-105506420 GTATTTCAGTCTTTTCCATGTGG + Intronic
961801593 3:129454626-129454648 CTGTTTCTGTCTCATCCTAGTGG + Intronic
963486593 3:145941991-145942013 ATATTTCTGTCCCAGCAAAGAGG + Intergenic
966408996 3:179629527-179629549 ATATTTCAGGCTTCTCCAAACGG - Intergenic
969066405 4:4485322-4485344 CTATTTCAGTCTCACCCATAGGG + Intronic
970262741 4:14245540-14245562 ATAATTCAGTTTCTTCCAATTGG - Intergenic
970894467 4:21086202-21086224 TTATTTCAGTCTCATTCTGGTGG + Intronic
972841829 4:42939928-42939950 ATACTTCTGTCTCAACTAAGGGG - Intronic
973739639 4:53907270-53907292 AAATTTCTGTCTCATCAAACCGG - Intronic
974845090 4:67342317-67342339 TTATTTCAATTTCATTCAAGAGG - Intergenic
974901980 4:68011520-68011542 ATCTTTCAATCACATCCATGAGG - Intergenic
975540764 4:75509380-75509402 ATCTTTCAGTTCCATCCAGGAGG - Intronic
975677147 4:76838431-76838453 ATATTTCATTGTCATTCAAGTGG + Intergenic
975677148 4:76838456-76838478 ATATTTCCTTGTCATTCAAGTGG + Intergenic
976348383 4:84031209-84031231 AAATTTCATTCCCATCCAAATGG - Intergenic
976886023 4:89985347-89985369 ATTATTCTGTATCATCCAAGTGG + Intergenic
978211193 4:106137416-106137438 GTATTTCAAGCTCATGCAAGAGG + Intronic
979072039 4:116220464-116220486 ATATTACATTCTCCTCCTAGTGG - Intergenic
979860189 4:125683493-125683515 CTGTTTCAGTCTCCTCAAAGGGG - Intergenic
980410267 4:132408778-132408800 TTATTTCAGTGTCATCCTACTGG + Intergenic
983470471 4:168148109-168148131 TTATTTCTGTCACAGCCAAGGGG + Intronic
984024775 4:174529928-174529950 ATATTTCACTCTCAGACAATAGG + Intergenic
984463286 4:180062628-180062650 ATATTTAAGTCTAAACCCAGTGG - Intergenic
985475444 5:76431-76453 AGTTTTCATTCTCATCAAAGGGG + Intergenic
985734234 5:1568514-1568536 ATATTGCAGCCTCATGGAAGAGG - Intergenic
986294350 5:6424594-6424616 ATGTCTGAGTCTCACCCAAGAGG + Intergenic
987927612 5:24363329-24363351 ATTTTGCACTGTCATCCAAGAGG - Intergenic
988259427 5:28865158-28865180 AAAATTCAGTGTCATCCAAATGG + Intergenic
995216857 5:109605297-109605319 ATATTTCAGTTGCTTTCAAGAGG + Intergenic
1001073548 5:168607042-168607064 GTTTTTCTGTCTCATCCAGGAGG + Intergenic
1001128468 5:169042677-169042699 ATATTACAGTCACATCAAAGGGG + Intronic
1001262773 5:170246053-170246075 ATATTTTAGACTCTTCAAAGAGG - Exonic
1010960020 6:82135247-82135269 ATTTTTCAGTGTTCTCCAAGGGG + Intergenic
1011345651 6:86367219-86367241 ATATGTCTGTCTCTTCCAAATGG - Intergenic
1013822791 6:114175346-114175368 AGATTTAAGTCTCTTTCAAGAGG - Intronic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1017330660 6:153194709-153194731 CTATTTCTGTCTCTTTCAAGTGG + Intergenic
1021283734 7:18752867-18752889 ATATTTCAGAATCATCTGAGGGG + Intronic
1022830156 7:34057662-34057684 ATATTTTAGTCTTATCAAACGGG + Intronic
1023151621 7:37206741-37206763 ATATTTCAGGATCATCCTGGAGG - Intronic
1023526573 7:41109750-41109772 ATATTTCAGTCTGAAGAAAGAGG + Intergenic
1025310357 7:57929498-57929520 ATATTTCCTTTTCATCCAAAGGG + Intergenic
1031861009 7:126980383-126980405 ATATTTTGGTTTCATTCAAGTGG + Intronic
1032761069 7:134942329-134942351 ATATTTCAGTCTCATCCAAGAGG + Intronic
1032762987 7:134962067-134962089 ATATTTCATACTTATCAAAGAGG - Intronic
1039197679 8:35050448-35050470 ATATGTCAGTTCCATCGAAGCGG + Intergenic
1042059966 8:64805847-64805869 ATATTTCTGTAGCATCCTAGTGG - Intergenic
1043656192 8:82670168-82670190 ATATTTCAGTATCTACCAGGTGG + Intergenic
1048967798 8:139626745-139626767 ATATTTCATTCTCTTCCAGCAGG - Intronic
1050268097 9:3912389-3912411 ATGTTTTAGTCTCTTCCAAGAGG - Intronic
1058982916 9:110186768-110186790 ATCTTTCTGTCTCATCCACATGG - Intergenic
1059181534 9:112217826-112217848 ATATTTTAGTCTCCTGGAAGTGG - Exonic
1060046208 9:120343245-120343267 AGATTTCTGTCTCTCCCAAGTGG - Intergenic
1060260677 9:122071244-122071266 ATATTTCAGCCTCACCGAGGAGG - Intronic
1185807613 X:3074463-3074485 ATATTTTATTTTCATCCAAGAGG + Intronic
1186090307 X:6039667-6039689 ATATTTTATACTCATCAAAGTGG - Intronic
1188432867 X:30126319-30126341 AGGTTTCTGTCTCATGCAAGAGG - Intergenic
1191113082 X:56822700-56822722 AGACTTCAGACTCATCCTAGTGG + Intergenic
1192255762 X:69456920-69456942 ATATGTCAGTCAGATCCAATTGG + Intergenic
1194715905 X:97286642-97286664 GTATTTCAGTCCTATCCAAGAGG - Intronic
1197168105 X:123401471-123401493 ATGTATCAGTCTCATCCCACTGG + Intronic
1198089540 X:133313887-133313909 ATTTTGCAGTCTCATCAATGTGG - Intronic
1201271215 Y:12256065-12256087 ATATTTTATTTTCATCCAAGAGG - Intergenic