ID: 1032762273

View in Genome Browser
Species Human (GRCh38)
Location 7:134954775-134954797
Sequence GGCACGCAGCGTGGTGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032762273 Original CRISPR GGCACGCAGCGTGGTGAGAC TGG (reversed) Intronic