ID: 1032773124

View in Genome Browser
Species Human (GRCh38)
Location 7:135079758-135079780
Sequence ATGTATAAAAAGATGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 592
Summary {0: 1, 1: 0, 2: 2, 3: 58, 4: 531}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032773124 Original CRISPR ATGTATAAAAAGATGAGGCT GGG (reversed) Intronic
901340909 1:8498398-8498420 ATTTATATATAGTTGAGGCTGGG + Intronic
902159874 1:14521164-14521186 ATGCAAATAAAGATCAGGCTTGG + Intergenic
902347237 1:15827393-15827415 ATTGATAAAAAGAGGAGGCAAGG - Intergenic
903019539 1:20384500-20384522 ATCTATAGACAGATGAGGCCAGG + Intergenic
903524563 1:23983325-23983347 ACCTAGAAAAAGATGATGCTGGG + Intergenic
903842489 1:26253683-26253705 ATGATGAAAAAGATGAGGCCGGG - Intronic
904150072 1:28431207-28431229 ATATATATAAACATGGGGCTGGG + Intronic
904186660 1:28710298-28710320 ATAAATACAAAGATCAGGCTGGG - Intronic
904270370 1:29345955-29345977 ATATATAAGAAGCTGAGGCCGGG + Intergenic
904399865 1:30249011-30249033 ATGTCAAAAATGCTGAGGCTGGG - Intergenic
905160217 1:36026401-36026423 ATTTAAAAACAGATGAGGCTGGG - Intronic
905830492 1:41062444-41062466 AAATATAAAAAAATTAGGCTGGG + Intronic
906351226 1:45061668-45061690 ATGTATACATAGGTCAGGCTGGG - Intronic
906796782 1:48702589-48702611 ATGTTAAAAAAGAAGAGGCCAGG - Intronic
907070709 1:51532123-51532145 AAGTATAATTAGAGGAGGCTCGG + Intergenic
907079108 1:51604950-51604972 ATTTATAAAAACATGAAGCTAGG - Intronic
907218017 1:52882973-52882995 AGATATGAAAAGATGAGTCTGGG - Intronic
907452601 1:54556041-54556063 CTGTATAAAAAAATCAGGCCAGG - Intronic
908018254 1:59870086-59870108 ATCTATAAAATGGTGAGACTGGG + Intronic
908029147 1:59981579-59981601 ATGAATGAAGAGGTGAGGCTTGG - Intergenic
908389618 1:63672773-63672795 TTGCATAATAAGATGAGGATGGG - Intergenic
908665855 1:66489800-66489822 ATCTATAAAAAGATAATGCAAGG + Intergenic
909032035 1:70553667-70553689 ATGTATAATAAGATCAGAATTGG + Intergenic
909832211 1:80206649-80206671 AGATATAATAAGATAAGGCTGGG - Intergenic
909843822 1:80364747-80364769 AAGTGTAAAAATATGAGGCCGGG + Intergenic
910216437 1:84849079-84849101 TTGTATAAAAAGTTCTGGCTGGG + Intronic
910534088 1:88276661-88276683 AAGTATAAAAAGATAAAGCTAGG + Intergenic
910554161 1:88511983-88512005 ATGTATATAATGATGACCCTAGG - Intergenic
912281361 1:108317968-108317990 ATCTATAAAATGATGACACTAGG - Intergenic
912327656 1:108784260-108784282 ATGAATAAATAGCTGAGACTGGG + Intronic
914423892 1:147556417-147556439 ATAAATAAATAAATGAGGCTGGG - Intronic
914701228 1:150135951-150135973 AGGTATAAAAATTTGAGGCCGGG + Intronic
914721088 1:150289643-150289665 ATGTATCAAATGAGGAGGTTGGG - Intergenic
914895188 1:151664431-151664453 AAATATACAAAGATGAGGCCAGG - Intronic
914925791 1:151885412-151885434 AAGAAATAAAAGATGAGGCTGGG - Intronic
915918532 1:159956817-159956839 ATGTATAAAAAGGTTAAACTAGG + Intergenic
916097261 1:161362446-161362468 ATGTGTAGGAAGATGATGCTGGG - Exonic
916592847 1:166209756-166209778 ATAAATAAAAAGACAAGGCTGGG - Intergenic
916673496 1:167046142-167046164 ATATATAAGCAGATGAGGCCAGG + Intergenic
916986799 1:170200499-170200521 ATAAATAAAAAGATGATGTTAGG + Intergenic
918062357 1:181072948-181072970 ATGTATAGAAAGATGGGAGTGGG - Intergenic
918478859 1:184955630-184955652 ATGTAAGAAAAGTTGAGTCTGGG - Intronic
919180995 1:194081668-194081690 ATGCAGTAAAAGATGAGCCTAGG + Intergenic
919217890 1:194583642-194583664 ATGTCTAGAAAGAGGAGGTTAGG - Intergenic
919475471 1:198028023-198028045 AACTATAAAAAGTTGAGGCTAGG + Intergenic
919997434 1:202766208-202766230 ACCTATAAAAGGAAGAGGCTGGG + Intronic
920821112 1:209381894-209381916 ATGAAAAAACAAATGAGGCTGGG - Intergenic
921106821 1:211989524-211989546 ATATATAAAAAGTTCTGGCTGGG + Intronic
921512338 1:216047460-216047482 ATGGAGAAAATGCTGAGGCTGGG + Intronic
921882966 1:220274974-220274996 GTTTATAAAATGAAGAGGCTGGG + Intergenic
922109668 1:222544662-222544684 ATCCATAAGAAAATGAGGCTGGG - Intronic
922529333 1:226331463-226331485 CTTTAAAAAAAAATGAGGCTGGG - Intergenic
922968836 1:229717068-229717090 TTGTATAAAGGTATGAGGCTTGG - Intergenic
923289739 1:232532911-232532933 ATACAGAACAAGATGAGGCTGGG + Intronic
923453994 1:234146807-234146829 ATGGAAAGAAAGATGAGGCCGGG - Intronic
923494591 1:234513211-234513233 CTATATAAGAAGAGGAGGCTGGG + Intergenic
923588216 1:235294807-235294829 ATTTTTAAAAAGATATGGCTGGG - Intronic
924361030 1:243242122-243242144 AAATATAACAAGATGAGGGTAGG - Intronic
924734839 1:246746543-246746565 AAGAATAAAAAGAAGTGGCTAGG + Intronic
924755041 1:246932664-246932686 TTGACTAAAAAGATTAGGCTAGG - Intergenic
1062918001 10:1256601-1256623 ATATATCAAAAGATGGGGCCAGG + Intronic
1063069252 10:2643484-2643506 ATGTTTAAAAAGATCCGGCCGGG - Intergenic
1063820102 10:9824988-9825010 TTGCATAATAAGATGAGGGTGGG - Intergenic
1063896425 10:10686889-10686911 ACATATAAGAAGATAAGGCTGGG - Intergenic
1064756881 10:18579463-18579485 ATGAATAAAAATATGAGGCCGGG - Intronic
1064952986 10:20875032-20875054 CTGTAGAAAAATGTGAGGCTGGG - Intronic
1065414910 10:25473770-25473792 AGGTAATATAAGATGAGGCTGGG - Intronic
1066591688 10:37001648-37001670 AGGTATAATAAGATGAGGCCAGG - Intergenic
1066610368 10:37240372-37240394 ATGCATTACAAGATGAGTCTTGG - Intronic
1068255688 10:54507237-54507259 ATCTGTAAAATGATAAGGCTAGG - Intronic
1068559464 10:58497213-58497235 ATGTATTGAAAGATGGGTCTTGG + Intergenic
1070737128 10:78870800-78870822 CTGTAGAGAATGATGAGGCTGGG + Intergenic
1072519675 10:96220021-96220043 TTGTATAATAAGATTAGGGTGGG + Intronic
1072740083 10:97903987-97904009 AGGTCTAAAAAGCTGAGGCCTGG + Intronic
1073813225 10:107174501-107174523 ATGTATTGAAAGATGTGGCCGGG - Intergenic
1073833701 10:107416325-107416347 ATGTAGAAATACCTGAGGCTGGG + Intergenic
1076121104 10:127937141-127937163 ATGAATAAAATGATGCAGCTAGG - Intronic
1077258704 11:1604053-1604075 ATGTAAAAAAAGATGTGTCTTGG + Intergenic
1077617134 11:3684277-3684299 ATGTTCAAAAAGTTGGGGCTTGG + Intronic
1078173971 11:8954855-8954877 ATGTAAAAAAAAATTAGGCCAGG + Intronic
1078389430 11:10923750-10923772 ATATATAAAAACATGAGGGCTGG - Intergenic
1078855742 11:15205469-15205491 ATGTATAGTAATATGATGCTTGG + Intronic
1078952660 11:16152662-16152684 GTGTCTAAAAACATGAAGCTAGG - Intronic
1079084502 11:17435637-17435659 ATGTGTAGGAAGATGATGCTGGG + Intronic
1079167842 11:18063519-18063541 ATGAATACAAAAATGAAGCTGGG + Intergenic
1079780445 11:24595668-24595690 ATTTATAAATAAATGAAGCTAGG + Intronic
1079959596 11:26906635-26906657 ATTAATAAAAAGAAGGGGCTTGG - Intergenic
1080157645 11:29130720-29130742 AAGTAGCAAGAGATGAGGCTGGG + Intergenic
1080883942 11:36348416-36348438 ATGCATAGAAAGGTGAGGCAGGG - Intronic
1081341195 11:41929587-41929609 TTATATAAAAAGGTAAGGCTGGG - Intergenic
1081360954 11:42177422-42177444 ATGTACAAGAAGATGTGGATAGG + Intergenic
1081446707 11:43137928-43137950 ATGTGTAAAAACATGGGCCTAGG + Intergenic
1082083596 11:48031151-48031173 AAATAACAAAAGATGAGGCTAGG - Intronic
1083181901 11:60992172-60992194 AAAAATAAAAAAATGAGGCTGGG - Intronic
1083908801 11:65692957-65692979 ATCAATAAATAGATGAGGCCGGG + Intergenic
1083914646 11:65733447-65733469 ATTATTAAAAAGATGAGGCTGGG + Intergenic
1084397507 11:68922687-68922709 ATGTTAAAAAACATGAGGCCGGG - Intronic
1086491847 11:87363670-87363692 ATGTATATAAAAATGAGGAATGG - Intergenic
1087589660 11:100170949-100170971 ATGTATAAAAAGAAGAGTGTGGG - Intronic
1087848462 11:103000395-103000417 ATGTTGAAAAACATGTGGCTAGG - Intergenic
1089476347 11:118766122-118766144 ATGTATTAAAAAATTGGGCTGGG + Intronic
1090226742 11:125076354-125076376 ATGTCTAAAATGATGGGGGTAGG - Intronic
1090526020 11:127537757-127537779 ATTTAACAAAAGATGAGGTTAGG + Intergenic
1090593952 11:128300317-128300339 AGGGAAGAAAAGATGAGGCTTGG - Intergenic
1090604461 11:128406936-128406958 TTCTATAAAATGAAGAGGCTTGG + Intergenic
1091494806 12:962866-962888 AAGTATAAAAAAATTAGGCATGG - Intronic
1091634277 12:2185543-2185565 ATTTATAAAAAGAAGAAACTTGG + Intronic
1092870097 12:12798513-12798535 ATAAATAAAAAGAAGAGGATTGG + Intronic
1093464420 12:19435537-19435559 ATGAATAAAAAGTTGATGTTGGG - Intronic
1093845095 12:23961388-23961410 ATGTAGGGAGAGATGAGGCTGGG - Intergenic
1093976217 12:25425143-25425165 AAGTATGGAAAGATGAGGCGAGG + Intronic
1094020249 12:25906254-25906276 TTTTAAAAAAAGATTAGGCTGGG - Intergenic
1094397729 12:30025831-30025853 ATGTAGAAATAGCTGAGACTAGG + Intergenic
1094677712 12:32637294-32637316 ATTTATAAATAAAGGAGGCTTGG + Intronic
1095427659 12:42094360-42094382 AAAAAAAAAAAGATGAGGCTGGG + Intronic
1095691047 12:45088935-45088957 ATGTATTATAATTTGAGGCTTGG - Intergenic
1096074470 12:48794064-48794086 ATAAATGAATAGATGAGGCTGGG + Intergenic
1096128346 12:49136696-49136718 ATATATAAAAAAAATAGGCTGGG - Intergenic
1096870610 12:54589953-54589975 ATGTGTAAAAAGATATGGCTGGG - Intergenic
1098225755 12:68321377-68321399 ATTTATATAAAGCTGGGGCTTGG - Exonic
1098497809 12:71156879-71156901 AGGTATGAAAAGAGCAGGCTGGG - Intronic
1098526531 12:71493280-71493302 ATGGATAAAAAGAGCAGGATGGG - Intronic
1099273941 12:80551268-80551290 TTGTATAAAACTATGAGGCTTGG - Intronic
1100160397 12:91853534-91853556 AAGAATAAAAAGATGAGTCAGGG + Intergenic
1100543379 12:95578985-95579007 ATGGAGAAAAAGACCAGGCTGGG + Intergenic
1100544374 12:95587331-95587353 ATTTATAAAATGGGGAGGCTGGG + Intergenic
1101180680 12:102213469-102213491 TTGTAGAAAAAGATGAGAATGGG + Intergenic
1101283269 12:103281644-103281666 ATGTATTAAAAGACCAGGCACGG - Intronic
1101345778 12:103884976-103884998 ATGTGTATAAAGATGATGCTGGG - Intergenic
1101418877 12:104532598-104532620 ATGTGTAAAAATTTGAGGTTGGG - Intronic
1101664225 12:106795559-106795581 TTGCATAATAAGATGAGGTTGGG - Intronic
1101765384 12:107693568-107693590 ATATATAAAAATACAAGGCTGGG + Intronic
1102944599 12:116974904-116974926 ATAAATAAAAAGATGAAGGTAGG + Intronic
1103137524 12:118520268-118520290 ATATTTAAAAAGCAGAGGCTGGG - Intergenic
1104265607 12:127229731-127229753 ATATATAAAAAAAAGAGCCTGGG - Intergenic
1104539262 12:129647093-129647115 ATGTATAAAAACATGTGGTTGGG - Intronic
1105555538 13:21444758-21444780 CTGTATAAAAATATAGGGCTGGG + Intronic
1105880623 13:24602975-24602997 ATGTACAAAGAACTGAGGCTGGG - Intergenic
1106381743 13:29245990-29246012 ATATTAAAATAGATGAGGCTGGG - Intronic
1106811685 13:33364592-33364614 ATTAAGAAAAAGAGGAGGCTGGG + Intergenic
1107170762 13:37340451-37340473 TTGGATAAAAAGATGTGCCTGGG + Intergenic
1109821782 13:67666523-67666545 GTTTATATAAAGTTGAGGCTGGG - Intergenic
1111693998 13:91600375-91600397 ATGTATATAAAGACATGGCTGGG + Intronic
1111709091 13:91788737-91788759 GTGTATAAATAGAGGTGGCTGGG + Intronic
1112249232 13:97763849-97763871 AAGCATGAGAAGATGAGGCTGGG + Intergenic
1112534770 13:100241758-100241780 ATGAATAAATAGATAAGGCCAGG - Intronic
1112678042 13:101727354-101727376 TTGTATAACCAGATGAGGTTAGG + Intronic
1113095196 13:106655767-106655789 AGGTGTCAAAAGATGAGTCTTGG + Intergenic
1113303986 13:109056514-109056536 ATGTACCTAAAGATGAGGCCTGG - Intronic
1114686532 14:24537269-24537291 ATATATAAGAGGCTGAGGCTAGG - Intergenic
1114894464 14:26969827-26969849 TTCTAAAAAAAAATGAGGCTGGG + Intergenic
1115644493 14:35358861-35358883 ATATAGACAAAAATGAGGCTGGG + Intergenic
1116004501 14:39277951-39277973 ATTAAAAAAAAGATGAAGCTGGG - Intronic
1116188123 14:41625496-41625518 ATGAAGAAATAGCTGAGGCTTGG - Intronic
1116751900 14:48896890-48896912 AAGTATAAAGAGATGAGCCTAGG + Intergenic
1116812859 14:49556056-49556078 ATTTAAAAAAAAATGGGGCTGGG - Intergenic
1117160095 14:52980921-52980943 AAGTTTAAACAGATGGGGCTGGG - Intergenic
1117223875 14:53635087-53635109 ATGGATAATAGGATGAGTCTGGG - Intergenic
1117777236 14:59195436-59195458 AAGTATAACAAGATGAGGCCAGG - Intronic
1118220291 14:63849654-63849676 AAGTATAAACACATGAGGGTGGG + Intergenic
1118408345 14:65450276-65450298 AAGTATAAAATAAAGAGGCTAGG - Intronic
1119414276 14:74459218-74459240 ATGCATAAAAACAGGTGGCTGGG + Intergenic
1119433546 14:74583705-74583727 ATGGATAAATAAATGAGGCTAGG - Intronic
1120511091 14:85415311-85415333 ATGTATGAAATGTTGACGCTAGG + Intergenic
1120592687 14:86394667-86394689 ATTTATAAACAAAAGAGGCTGGG + Intergenic
1121090623 14:91179454-91179476 AAATATATATAGATGAGGCTGGG + Intronic
1121236662 14:92396400-92396422 AAGTAGAAACAGATGAGGTTGGG + Intronic
1121344203 14:93123239-93123261 ATGTTTAAAAAGAAAAGGCTGGG + Intergenic
1121726314 14:96153606-96153628 ATATATAAAAATTTGAGGCCGGG - Intergenic
1122091691 14:99345197-99345219 ATATCTAAAAAAATAAGGCTCGG - Intergenic
1123009930 14:105344210-105344232 ATATATTAAAAGTTGAGGCAGGG - Intronic
1124158058 15:27245576-27245598 ATGTATAAAGAAAATAGGCTGGG + Intronic
1124668555 15:31616418-31616440 ATATGTGAAAAGAAGAGGCTGGG + Intronic
1125884924 15:43221428-43221450 ATGTATTAAAAGTAGAAGCTGGG + Intergenic
1126166057 15:45654905-45654927 TTGCATAATAAGATGAGGGTGGG - Intronic
1127652782 15:61025136-61025158 ATGTATAAAATGATGAGCCAGGG + Intronic
1128522619 15:68385840-68385862 ATCTGTAAAATCATGAGGCTGGG + Intronic
1128628072 15:69232083-69232105 ATATATAAAAATCTGAGGCCGGG - Intronic
1128918907 15:71593100-71593122 ATGGACAAAGAGATAAGGCTGGG - Intronic
1129572881 15:76708768-76708790 AAGAATGAAAAGAGGAGGCTGGG + Intronic
1129874798 15:78967005-78967027 TTTTAAAAAAAAATGAGGCTGGG + Intronic
1130159177 15:81382005-81382027 GTGGAGAAAAAGGTGAGGCTGGG + Intergenic
1130747787 15:86674676-86674698 ATTTATGATAAGATGTGGCTTGG + Intronic
1131789255 15:95946582-95946604 AATTATATAAAGATGAGACTAGG - Intergenic
1133375914 16:5287007-5287029 CTATTTAAAAAGAAGAGGCTGGG + Intergenic
1133530892 16:6653886-6653908 ATGGATAAAAAGATGAATTTGGG + Intronic
1133562057 16:6959639-6959661 AAATATTAAAAGCTGAGGCTGGG + Intronic
1134731765 16:16468369-16468391 ATGTATAAACAGCAGAGGTTTGG + Intergenic
1135527318 16:23223715-23223737 AGGTATGAGCAGATGAGGCTGGG - Intergenic
1135982957 16:27162857-27162879 TTGTATAATAAGATGTGTCTGGG + Intergenic
1136988159 16:35132235-35132257 ATGTATTAAAATATGTGGCTTGG + Intergenic
1137515476 16:49139885-49139907 ATTTATAAATACATGAGTCTGGG + Intergenic
1137649752 16:50109819-50109841 ATGTATAAAATGTAGAGGCGGGG - Intergenic
1137963003 16:52903590-52903612 ATATATGAACAGATGAGGATAGG - Intergenic
1137994926 16:53200076-53200098 AAATACAAAAACATGAGGCTGGG + Intronic
1138011650 16:53386385-53386407 AAGAATAAAAACATGAGGCCGGG - Intergenic
1138454111 16:57111466-57111488 ATTTATAACAAGATGGGGCGTGG - Intronic
1138714446 16:59005259-59005281 AAGAATAAGAAGATTAGGCTGGG + Intergenic
1138775361 16:59716356-59716378 ATGAGTAGAAAGATGAGGATGGG + Intronic
1138845798 16:60564207-60564229 ATGAATAATTAGAGGAGGCTAGG + Intergenic
1138873933 16:60926731-60926753 ATGAAGAACAGGATGAGGCTGGG - Intergenic
1139439832 16:66960792-66960814 GTGTGTGAAAACATGAGGCTTGG - Intergenic
1139746174 16:69076385-69076407 ATGTATCAAGAAATGAGGCTGGG - Intronic
1139839407 16:69866416-69866438 ATATCTAATAAAATGAGGCTAGG - Intronic
1140631943 16:76863996-76864018 ATATATAAAAAGATAAGATTTGG + Intergenic
1140676585 16:77338197-77338219 ATGTATGAAAAGATGGAGCCAGG - Intronic
1141069646 16:80942108-80942130 CTCTATAAAAAGAAGAGGTTGGG - Intergenic
1142400677 16:89856762-89856784 AAATAAAAAATGATGAGGCTGGG + Intronic
1142731060 17:1858004-1858026 ATGTGTAGGAAGATGATGCTGGG + Intronic
1142792501 17:2278498-2278520 ATGTATATATAGTTTAGGCTGGG - Intronic
1142839913 17:2620075-2620097 ATTTATGAAAATATGGGGCTGGG - Intronic
1142867957 17:2802324-2802346 TTGTTCAAAAAGGTGAGGCTGGG + Intronic
1143810157 17:9465014-9465036 GTGTATAAGAGGATGAGGCCGGG - Intronic
1143958184 17:10691730-10691752 GTGAATAAAAAGGTGAAGCTAGG - Intronic
1146392133 17:32432377-32432399 ATATATAAAAACAACAGGCTGGG - Intergenic
1146773007 17:35586247-35586269 ATGTATAGAAAAAAAAGGCTAGG - Intronic
1150599653 17:66639699-66639721 ATTAATAAACAGAGGAGGCTGGG + Intronic
1150646352 17:66980047-66980069 AAGAATAAAAAGAACAGGCTGGG - Intronic
1150681334 17:67286877-67286899 ATGTATAAAAGAATGAGTGTGGG - Intergenic
1150749275 17:67845036-67845058 ATGTAAAAAACAATCAGGCTGGG - Intronic
1151687200 17:75655084-75655106 ATGTTTAAAAATGTTAGGCTGGG - Intronic
1151907630 17:77059258-77059280 AGCTATAAAAAGGAGAGGCTGGG + Intergenic
1152043471 17:77920284-77920306 ATTAAAAAAAAGAAGAGGCTGGG + Intergenic
1152053838 17:78005645-78005667 AGGTATAAAAGGAAGAGGCTTGG - Intronic
1153460134 18:5324087-5324109 AGGTATGAAAAGATGAAGCCTGG + Intergenic
1153795915 18:8621963-8621985 ATGAATAAAAATAAAAGGCTAGG - Intronic
1153851467 18:9099355-9099377 TTGTATAATAAGATTAGGGTTGG + Intergenic
1154944178 18:21145273-21145295 TTGTATTAAAAGAGGAAGCTAGG + Intergenic
1155473189 18:26212136-26212158 ATGAAAAAAAACATAAGGCTGGG + Intergenic
1155879975 18:31133594-31133616 ATGTGTAAAATGAAGAGGCTGGG - Intronic
1156928353 18:42610669-42610691 ATGTATGGAAAAATGAGGATAGG - Intergenic
1157354754 18:46922496-46922518 AAAAATAAAAAGTTGAGGCTGGG + Intronic
1157693410 18:49701581-49701603 ATCTATAAAATGATGGGGCTGGG + Intergenic
1158185661 18:54768618-54768640 ATGAATAAATAGCTGAGACTGGG + Intronic
1159201312 18:65188613-65188635 ATGTGTCAAGAGAAGAGGCTGGG - Intergenic
1159316665 18:66783847-66783869 ATCTTTAAAAAGGTGATGCTAGG + Intergenic
1159382249 18:67675317-67675339 ATGAATAAAAAGAAAAGTCTAGG + Intergenic
1159928529 18:74290543-74290565 CTGTTTTAAAAAATGAGGCTGGG - Intronic
1160003867 18:75053758-75053780 GTGTAGAAAAGGCTGAGGCTGGG + Intronic
1160114848 18:76068219-76068241 ATATATACACAGATCAGGCTGGG - Intergenic
1160257926 18:77263392-77263414 GTGTTTAAATAGATGAGGCATGG + Intronic
1160294394 18:77623980-77624002 AGGGTTAAAAAGATGAGGCCAGG + Intergenic
1161827715 19:6580080-6580102 AAATTTCAAAAGATGAGGCTGGG + Intergenic
1161862846 19:6811329-6811351 TTGAATAAATAAATGAGGCTGGG - Intronic
1162213912 19:9116317-9116339 AAAAAAAAAAAGATGAGGCTGGG - Intergenic
1163081981 19:14950620-14950642 ATTTTTTAAAAAATGAGGCTGGG + Intronic
1164064354 19:21702800-21702822 AAACATAAAAAGCTGAGGCTGGG + Intergenic
1164798991 19:31060301-31060323 ATGTATAATAAGGGGATGCTTGG + Intergenic
1166392780 19:42419296-42419318 ATAAATAAAAAGATGAGGAGAGG + Intronic
1166618765 19:44276068-44276090 ATATTTAAAAAGAAGAGGCTGGG + Intronic
1166925036 19:46261296-46261318 ATTTAGAAAAAGATGGGGCTGGG + Intergenic
1166962898 19:46509989-46510011 TTGTTTAAAAAGATGATACTGGG + Intronic
1166967874 19:46541259-46541281 ATGAATGAAAAAATGAGGCCGGG + Intronic
1167599727 19:50447560-50447582 CTGTATAAAAACATCAGGCCGGG + Intronic
1167599961 19:50449045-50449067 AGGTTTAAAAGGATGAGGATTGG + Intronic
1168298952 19:55392526-55392548 AAAAAAAAAAAGATGAGGCTGGG - Intronic
1168299014 19:55392828-55392850 AGACATTAAAAGATGAGGCTGGG - Intronic
925591588 2:5515246-5515268 CTGTCTAAAAAGATAGGGCTTGG - Intergenic
926765307 2:16318661-16318683 AGCTATAAAAGGAGGAGGCTGGG + Intergenic
926988982 2:18656423-18656445 ATTTATAAAATGAGGAGGCAGGG + Intergenic
927019484 2:19001837-19001859 ATGTATAAAATGAAGGGGCTAGG - Intergenic
927593300 2:24375295-24375317 ATGTAGAAAAAAATCACGCTGGG - Intergenic
927882199 2:26696721-26696743 AGCTATGAATAGATGAGGCTTGG - Intronic
928283824 2:29971841-29971863 ATAAAGAATAAGATGAGGCTGGG + Intergenic
928561836 2:32496517-32496539 CTGTATGAACAAATGAGGCTGGG - Intronic
928742604 2:34372739-34372761 ATATATATAAAGATGTGGTTTGG + Intergenic
928858236 2:35826017-35826039 ATGTAGAAAAATCTGAGACTGGG + Intergenic
928868055 2:35942091-35942113 AGGAATAAAAATATGAAGCTGGG - Intergenic
929148757 2:38729496-38729518 CTCTATATAAAGATGAGACTTGG + Intronic
929149395 2:38734101-38734123 ATAAATAAAAAGTTGAGGCCGGG + Exonic
929354942 2:41011006-41011028 AAATAAAAAAATATGAGGCTCGG - Intergenic
929780090 2:44952042-44952064 TTTTCTGAAAAGATGAGGCTTGG + Intergenic
930142694 2:47968819-47968841 ATTTTTAAAAAGTTCAGGCTGGG + Intergenic
930218495 2:48721853-48721875 AGGTATAAAGAAATGAGGCCGGG + Intronic
930401951 2:50901238-50901260 AAGAAAACAAAGATGAGGCTGGG + Intronic
930507002 2:52295079-52295101 ATGTATAAAAAAATTATTCTTGG + Intergenic
931359506 2:61566182-61566204 ATATATATAAAAATTAGGCTGGG - Intergenic
931416407 2:62085682-62085704 ATTTTTAAGAAAATGAGGCTGGG + Intronic
932107767 2:68962474-68962496 ATGTATAAAAAAATCAGGCTGGG - Intergenic
932502627 2:72197334-72197356 ATGGAGGAAAAGATCAGGCTTGG - Intronic
934551591 2:95266152-95266174 ATTTATAAAGAAAAGAGGCTGGG - Intergenic
935186529 2:100739296-100739318 ATTTTAAAAGAGATGAGGCTGGG + Intergenic
935405036 2:102699891-102699913 ACTTATAAAAAGAAGAGGTTTGG - Intronic
936393495 2:112098275-112098297 ATTTAATAAAAGAAGAGGCTGGG + Intronic
936590483 2:113798904-113798926 ATATAGAAAAAAATGTGGCTGGG - Intergenic
937175166 2:119923840-119923862 AACTTTAAAAAAATGAGGCTGGG + Intronic
937633593 2:124130529-124130551 AAGTTTCAAAAAATGAGGCTTGG + Intronic
937742351 2:125370539-125370561 ATTTATAAAATGATGAGATTGGG - Intergenic
938514955 2:131994325-131994347 ATGTATACAAACTAGAGGCTAGG + Intergenic
939035860 2:137130362-137130384 AATAATAAAAAGGTGAGGCTTGG - Intronic
939151053 2:138473070-138473092 ATGTAAAAATAACTGAGGCTGGG - Intergenic
939195891 2:138971495-138971517 ATGTATAAAATGATGAGTGAGGG - Intergenic
940138073 2:150461573-150461595 ATGTGGTAAGAGATGAGGCTCGG + Intergenic
940311673 2:152285804-152285826 ATTTTTAAAAATATGAGCCTTGG + Intergenic
941129493 2:161628772-161628794 ATGTATAAAATGCTAAGGTTGGG + Intronic
941540489 2:166776975-166776997 ATGTATATAGAGAAGAGGCAGGG + Intergenic
941997172 2:171611713-171611735 ATGTATAAAGAAAAGAGGTTTGG - Intergenic
942006769 2:171710010-171710032 AAGGTTAAAAAGATGTGGCTGGG - Intronic
942068499 2:172294199-172294221 AGGCATAAAGAGATCAGGCTTGG - Intergenic
942668683 2:178350258-178350280 ATGTTTAACAAGAAGAGTCTAGG + Intronic
943534938 2:189136668-189136690 AAGTATAGAAAGATCAGGTTTGG - Intronic
943671063 2:190661224-190661246 TTATTTAAAAAGATCAGGCTAGG - Intronic
943799389 2:192038780-192038802 AAGTATAGAAAGAGGAGGCTGGG - Intronic
943984490 2:194602873-194602895 TTGTATAATAAGATTAGGGTGGG + Intergenic
944823892 2:203460819-203460841 AAATATATAAAGATGAGGCCAGG + Intronic
945246249 2:207719880-207719902 AGGTTTAAAAAGATAAGACTTGG + Intronic
945609985 2:211988326-211988348 ATGGATAAGGGGATGAGGCTTGG - Intronic
945759808 2:213901100-213901122 ATGTAAAATAAGATAAAGCTAGG + Intronic
946555819 2:220855948-220855970 ATGTAGAATAAGATGATACTAGG + Intergenic
947386008 2:229591125-229591147 ATGAAGAAATACATGAGGCTGGG - Intronic
947427368 2:229995978-229996000 ATGTATAAAAATAACAGGCTGGG + Intronic
947729029 2:232418060-232418082 ATGTACAGAAAGATGACGCTGGG - Intergenic
947740980 2:232484826-232484848 ATGTACAACAAGGTGACGCTGGG - Exonic
948006549 2:234613967-234613989 ATGTATAAACAGAAAAGGTTTGG + Intergenic
948177570 2:235956172-235956194 ATGTAAAAAGGGAAGAGGCTGGG + Intronic
1169639592 20:7735655-7735677 ACGAATAAAAGGAAGAGGCTGGG + Intergenic
1170529481 20:17276517-17276539 ATGTATCACAAGATGGGGCTAGG + Intronic
1170619270 20:17980512-17980534 ATTTAAAAAAAAATCAGGCTGGG + Intronic
1171341008 20:24429290-24429312 ATATATAATAACATGATGCTGGG + Intergenic
1172065040 20:32213475-32213497 AAAAATATAAAGATGAGGCTGGG + Intronic
1172488234 20:35313079-35313101 TTTTTTAAAAAGATGAGGCCAGG + Intronic
1173260281 20:41428746-41428768 ATGTAGAAAAAGAAGAGGGCAGG + Intronic
1174852128 20:54005857-54005879 ATGCAGAAAAAGATGAGGTGGGG + Intronic
1175267843 20:57713394-57713416 ATGTGTAAAAAGATGAGTCCAGG + Intergenic
1175932977 20:62502155-62502177 ATGTATAAAGAAAAGAGGTTTGG - Intergenic
1176889829 21:14301623-14301645 ATTTATAAAAAGAAGAGGAAGGG + Intergenic
1177102337 21:16914014-16914036 ATGTAAAAATAAATGAGGCCGGG - Intergenic
1177438223 21:21083708-21083730 ATTTTAAAAAAGATGAGGCTGGG - Intronic
1177976469 21:27857722-27857744 ATGTATACAAACTAGAGGCTAGG - Intergenic
1179237269 21:39559065-39559087 TTGCATAATAAGATGAGGGTGGG - Intronic
1180230340 21:46423483-46423505 TTGTATAAAAATTTGAGGCCAGG - Intronic
1183208802 22:36437343-36437365 ATAAATAAAAAGATCAGGCAGGG - Intergenic
1183556830 22:38535002-38535024 ATCTAAAAAAAAAAGAGGCTGGG + Intronic
1184725051 22:46339465-46339487 ATTATTAAAAAGATGAGTCTGGG + Intronic
1184939851 22:47755956-47755978 AAGGAAAAAAAAATGAGGCTAGG + Intergenic
1185005516 22:48274369-48274391 ATGAAGAAAAATAAGAGGCTAGG + Intergenic
1185357785 22:50385042-50385064 CTTTATAAAAAGAAGAGGTTAGG - Intronic
949708660 3:6848257-6848279 ATGTGTAAAAACTTGAGGGTGGG + Intronic
950397649 3:12746191-12746213 ATTTATAAAGAAAAGAGGCTGGG - Intronic
950621014 3:14205370-14205392 ATGTATAAAACTATGAGCTTGGG - Intergenic
950719507 3:14872686-14872708 ATATGTCAAAAGATGAAGCTGGG + Intronic
950747798 3:15104566-15104588 ATGAGAAAAAGGATGAGGCTGGG + Intergenic
951094008 3:18607521-18607543 AAGTATGAAAATATGAGGTTGGG - Intergenic
951223919 3:20098548-20098570 ATCTATAAGATGATGAAGCTGGG - Intronic
951934345 3:28004912-28004934 AAATATAACAAGTTGAGGCTGGG + Intergenic
952029876 3:29128884-29128906 ATTTTTAAAAAGAAGGGGCTTGG + Intergenic
952223180 3:31345763-31345785 AAGTAGAAAAGGATGAGTCTGGG - Intergenic
952224373 3:31359400-31359422 ATGTTTAAACAGATTCGGCTTGG + Intergenic
952482363 3:33774767-33774789 ATGTATTAAGAGAAAAGGCTGGG + Intergenic
953022723 3:39125957-39125979 GTGTATAAAAATATGATCCTTGG - Intronic
953342442 3:42146982-42147004 ATTTCTAAAAAGATGATGATGGG - Intronic
953521421 3:43646803-43646825 ATGTAAAGAAAGAAGAGGCCAGG - Intronic
953823574 3:46230852-46230874 ATGAATAAAAACATGTGCCTAGG - Intronic
954032333 3:47828474-47828496 AAAAAAAAAAAGATGAGGCTGGG + Intronic
956090556 3:65662040-65662062 AGAAATACAAAGATGAGGCTGGG - Intronic
956633644 3:71341471-71341493 ATATTTAAAAAGAAGAGGCAAGG + Intronic
957516161 3:81254213-81254235 TAGAATAAAAATATGAGGCTGGG + Intergenic
957807984 3:85176048-85176070 ATGTATCAAAAGATTAGGACAGG - Intronic
958652576 3:96956737-96956759 ATGTATAAAAAATGTAGGCTGGG + Intronic
958913170 3:100018031-100018053 ATGTATAAAAGGTGAAGGCTAGG + Intronic
959698516 3:109275422-109275444 ATGTTTAAAATATTGAGGCTGGG + Intergenic
959784703 3:110281662-110281684 ATGTATATATAGATGAGTCTTGG + Intergenic
959898862 3:111637444-111637466 ATGTATAAAAATCTAAGGCTTGG - Intronic
960287351 3:115844679-115844701 ATCTATAAAATGTTGGGGCTGGG + Intronic
961034506 3:123633085-123633107 ATAAATAAAAAGACAAGGCTGGG - Intronic
961849145 3:129797444-129797466 ATATATAAAACGTTTAGGCTGGG + Intronic
962399163 3:135042224-135042246 CCCTATAAAAAGATGAGGCCGGG - Intronic
962972946 3:140421741-140421763 ATGTATAAAATGTTGACTCTGGG + Intronic
963666595 3:148195951-148195973 ATCTAAAAAACGATGAGACTTGG + Intergenic
964906001 3:161721418-161721440 ATGAATAACAAAATGAGGCCGGG + Intergenic
965398378 3:168188207-168188229 ATGCTTAAAAAGATGAGACTTGG - Intergenic
965492118 3:169350350-169350372 ATTTATAAAATGAGTAGGCTGGG + Intronic
966006963 3:175026349-175026371 ATATCTAAAAAGTTCAGGCTGGG + Intronic
966295348 3:178414261-178414283 ATGTATTAAAACTCGAGGCTGGG + Intergenic
967105914 3:186254918-186254940 ATGTGCAGAAGGATGAGGCTAGG - Intronic
967217332 3:187221459-187221481 ATGTATACAAAAATGAAGTTTGG + Intronic
967823665 3:193861597-193861619 ATGTCTAAAAAGATGTTTCTTGG - Intergenic
967925870 3:194646814-194646836 ATGTTTAAAATAAGGAGGCTGGG - Intronic
968409438 4:375049-375071 ATGTGCAAAAAGATGAGCATTGG - Exonic
970319130 4:14858285-14858307 ATATAAAAAAAGATATGGCTTGG + Intergenic
970741289 4:19240947-19240969 ATGTATCAAATGATGAGGGTAGG + Intergenic
972079558 4:35133674-35133696 ATAAATAAATAAATGAGGCTGGG + Intergenic
972135925 4:35893903-35893925 ATGTCAAAAAAGACCAGGCTAGG + Intergenic
972246876 4:37254200-37254222 AAGTTTAAAAAAATCAGGCTGGG + Intronic
973703138 4:53555801-53555823 ATCTATAAAAGTATGATGCTAGG - Intronic
975051416 4:69869582-69869604 ATGTAAAAAAAGTTGAGCTTTGG - Intergenic
975564531 4:75739836-75739858 AACAATACAAAGATGAGGCTGGG - Intronic
975748412 4:77496914-77496936 ATATAAAAAAAGATGTGGCTTGG - Intergenic
976012764 4:80511257-80511279 ATATATGAAAAGATGAGAATGGG + Intronic
976240404 4:82949690-82949712 ATTTATAAAAAACTCAGGCTGGG - Intronic
976640588 4:87333720-87333742 ATAAAGAAAAAGATTAGGCTGGG + Intergenic
976723015 4:88188209-88188231 ATGTTTCAACATATGAGGCTGGG - Intronic
976986389 4:91304478-91304500 GTGTATAAAATGATGAGTCAAGG - Intronic
977100049 4:92799580-92799602 ATGTATAAAAAAGAGATGCTAGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
977931275 4:102751819-102751841 ATGTCTTAAAAGATGTGGCCTGG + Intronic
978983386 4:114980344-114980366 ATGTGTAATAAAATGTGGCTGGG + Intronic
979382661 4:120026708-120026730 ATGTATAAAAAGAAAGTGCTAGG - Intergenic
979682536 4:123477623-123477645 GTGTATAAAAACATGAGCTTTGG - Intergenic
980182144 4:129414347-129414369 ATGTATAAAATGAAGAGTCCTGG - Intergenic
980938648 4:139250634-139250656 AAGTATAAAAATATGAAGCGAGG - Intergenic
981439023 4:144761006-144761028 TTGTATAAGAAGATTAGGGTGGG - Intergenic
981604077 4:146523351-146523373 ATGTATAATTAGATGACACTTGG - Intergenic
983075184 4:163317058-163317080 ATGTAAGAAGAGTTGAGGCTTGG - Intergenic
983138807 4:164122482-164122504 TTGTATAATAAGATTAGGGTGGG + Intronic
984192968 4:176626136-176626158 TTGCATAAAAAGATTAGGGTGGG + Intergenic
984247021 4:177286997-177287019 CTGTATAAATACAAGAGGCTTGG + Intergenic
984440386 4:179762253-179762275 ATGCATAGAAAGATGAGACTTGG - Intergenic
984996171 4:185432565-185432587 ATAGATAAAAATATGAGGCTGGG + Intronic
985340620 4:188948783-188948805 ATTTAAGAAAAGATGAGGCCGGG - Intergenic
986398184 5:7351626-7351648 TTGCATAATAAGATTAGGCTGGG + Intergenic
986632100 5:9783775-9783797 ATGTATAATAAGATTTGTCTTGG - Intergenic
987346155 5:16980648-16980670 AAGAATAAAACAATGAGGCTAGG + Intergenic
988888582 5:35588117-35588139 GTATATAAAAAGATGAGTTTAGG - Intergenic
989571139 5:42947207-42947229 AAGAATAAAAAAATTAGGCTGGG + Intergenic
989791618 5:45410698-45410720 AAGTATAACAAGATAAGCCTAGG + Intronic
990188831 5:53235242-53235264 ATTTTTAAGAATATGAGGCTGGG - Intergenic
990247019 5:53873313-53873335 AAATAAAAACAGATGAGGCTGGG - Intergenic
990516098 5:56532144-56532166 ATGTATAAAAAAGGGAGCCTTGG - Intronic
990518286 5:56551562-56551584 ATGGATAAAAAGTTGAGGGAAGG - Intronic
990936195 5:61152218-61152240 AAATATTAATAGATGAGGCTTGG + Intronic
991106141 5:62844069-62844091 TTGTATAATAAGATTAGGGTGGG + Intergenic
991270389 5:64772327-64772349 ATATATAAAAAGATGATGACTGG + Intronic
991370036 5:65909028-65909050 ATATAAAAAAAAATGAGGCCAGG + Intergenic
991972084 5:72151035-72151057 ATGTAAAAAAAGAGGGGGTTTGG + Intronic
993090747 5:83423113-83423135 AGTTATCAAAAGATTAGGCTAGG + Intergenic
993880205 5:93352273-93352295 ATTTATACAAAGAATAGGCTGGG - Intergenic
994013135 5:94931644-94931666 AGGAATAAAATGATGAGGCTAGG - Intronic
994542682 5:101120793-101120815 AGGAATAAAAAGATGAGATTTGG + Intergenic
994579424 5:101620401-101620423 ATGAATAACAGGATGAAGCTGGG - Intergenic
994715902 5:103321201-103321223 ATGTAAACAAAAATGAGGCTGGG - Intergenic
995638461 5:114223703-114223725 GGGAATAAAAGGATGAGGCTAGG + Intergenic
995966408 5:117912466-117912488 ATGCATAATAAGATTAGGATGGG - Intergenic
997568962 5:134911081-134911103 AAGTATAAAAAGCTCAGGCTGGG - Intronic
998842401 5:146268860-146268882 AAGTTTAAAAATGTGAGGCTAGG - Intronic
999694900 5:154180082-154180104 CTGTTTAAAAAGGTGAGGCTGGG - Intronic
999883287 5:155891013-155891035 AAGCATAAAAAGAGGATGCTAGG + Intronic
999893308 5:156002204-156002226 CTGTATAAGAAGATGAGATTAGG + Intronic
1000331102 5:160206136-160206158 ATGTATAATAAAAGCAGGCTGGG + Intronic
1000371465 5:160540547-160540569 AAGAATAATAAAATGAGGCTGGG + Intergenic
1001710299 5:173773018-173773040 ATCTTTGAAAAGTTGAGGCTGGG + Intergenic
1001794158 5:174488179-174488201 AAGTATAAAAAAATTAGTCTGGG + Intergenic
1001976284 5:176002413-176002435 ATGCAAAAAAAAATGAGGCTGGG + Intronic
1001983227 5:176051277-176051299 ATCTTTAAAAAGATCAGGCAAGG + Intronic
1002038853 5:176495804-176495826 ATTAATAGAAAGTTGAGGCTGGG - Intronic
1002234238 5:177792775-177792797 ATCTTTAAAAAGATCAGGCAAGG - Intronic
1002241138 5:177841354-177841376 ATGCAAAAAAAAATGAGGCTGGG - Intergenic
1002805718 6:572302-572324 ATGTACAAAAAGAATAGTCTGGG - Intronic
1003343291 6:5242422-5242444 ATTTAAAAATACATGAGGCTGGG + Intronic
1003680841 6:8253685-8253707 ATGTATATGAAAATCAGGCTGGG + Intergenic
1004885684 6:20049783-20049805 ATTTAGAGAAAAATGAGGCTGGG - Intergenic
1004895008 6:20139848-20139870 TTGTATAGAAAGTTAAGGCTGGG - Intronic
1005182031 6:23116597-23116619 TTGTATAATAAGATTAGGGTGGG - Intergenic
1005248686 6:23918703-23918725 ATGGAAAATAAGAAGAGGCTGGG + Intergenic
1008151914 6:47963324-47963346 ATAAATAAAAAGATAAGTCTTGG + Intronic
1009705823 6:67250938-67250960 AAGTAGGAAAAGATGATGCTTGG + Intergenic
1010140831 6:72612828-72612850 ATGTATAACAAGATTTAGCTTGG - Intergenic
1012098218 6:94993480-94993502 ATGTGTAGGAAGATGATGCTGGG + Intergenic
1012459051 6:99440245-99440267 ATATATAAAAGGATGAGATTAGG + Intronic
1012635573 6:101535446-101535468 ATGTAAATAAAGTAGAGGCTAGG + Intronic
1013131497 6:107237542-107237564 AAGTATAAAAATAAGAGGCCAGG - Intronic
1013425264 6:110006256-110006278 ATTTGCAAAAAGATCAGGCTGGG - Intergenic
1015482762 6:133731555-133731577 ATGTATAAGGAGGTGAGGATTGG - Intergenic
1015942576 6:138466786-138466808 ACATATAAAAATATGAGGCCCGG + Intronic
1016871958 6:148826406-148826428 ATGAATAAAAACAGGAGCCTGGG - Intronic
1016879551 6:148897473-148897495 AAAAATAAAAAGATAAGGCTGGG - Intronic
1016941707 6:149487768-149487790 ATGTAAGAAAAGATGAGTCTGGG + Intergenic
1017241512 6:152174896-152174918 ACATTTAAAAAGCTGAGGCTGGG + Intronic
1017332379 6:153214952-153214974 AAATATAAAAACAAGAGGCTGGG + Intergenic
1017690446 6:156958818-156958840 AAGCAAAAAAAGATGAGGCCAGG + Intronic
1018080669 6:160257059-160257081 ATGTAAAGAAAACTGAGGCTGGG - Intronic
1018435614 6:163755769-163755791 ACAGATAGAAAGATGAGGCTTGG - Intergenic
1018667600 6:166153601-166153623 ATCATTAAAAAGAAGAGGCTAGG - Intergenic
1019527314 7:1486565-1486587 ATGTTTAAAATGAGTAGGCTGGG - Intronic
1019950159 7:4365621-4365643 ATGTGTAAAGAGACGAGGTTTGG - Intergenic
1020035720 7:4961828-4961850 ATAGATAGATAGATGAGGCTGGG - Intergenic
1020438976 7:8197257-8197279 ATTAAAAAAAAGAAGAGGCTGGG + Intronic
1020544883 7:9514820-9514842 TTGTATAAAAAAATAAGCCTTGG - Intergenic
1020653358 7:10901646-10901668 ATATATAAAAAAATCAGGCCGGG + Intergenic
1020746610 7:12087238-12087260 ATGAAGAAAAAGATAAGTCTAGG + Intergenic
1020809127 7:12829968-12829990 ATGTATCACAAGGTGAGACTGGG + Intergenic
1020838659 7:13186350-13186372 CTTTAAAAAAAGATGAGGCTGGG + Intergenic
1021651424 7:22837349-22837371 ATGAATTAAAATATGAGGCCCGG + Intergenic
1022109174 7:27217700-27217722 ATTTAAAAAAATAGGAGGCTGGG + Intergenic
1022209409 7:28194039-28194061 ATTAATAAAACGATGAGGCTGGG - Intergenic
1022425408 7:30264172-30264194 ACGTAAAAATAGTTGAGGCTGGG - Intergenic
1022732774 7:33046085-33046107 ATGATAAAAAACATGAGGCTGGG - Intronic
1022820883 7:33959625-33959647 ATGTATAAAAAGTTGCGGCAAGG + Intronic
1022988980 7:35688771-35688793 ATGTATAATAAGATGAAGAAAGG - Intronic
1024156930 7:46635783-46635805 ATTTTTAAAAAGATCAGGTTAGG + Intergenic
1024635303 7:51283988-51284010 ATATATAAAAAGAATAGGCTGGG + Intronic
1025214358 7:57043414-57043436 ATTTAGCATAAGATGAGGCTGGG - Intergenic
1025657595 7:63533399-63533421 ATTTAGCATAAGATGAGGCTGGG + Intergenic
1026608386 7:71835569-71835591 AAATTTAAAAAGATGAGGCCAGG - Intronic
1026613680 7:71883008-71883030 AGGTAAAGTAAGATGAGGCTGGG - Intronic
1026797168 7:73373786-73373808 GTGGAAGAAAAGATGAGGCTAGG - Intergenic
1027380559 7:77604507-77604529 AACTATTAAAAGATGAGGCTGGG - Intronic
1027752340 7:82165261-82165283 ATGTAGATATAAATGAGGCTGGG - Intronic
1028595426 7:92543414-92543436 ATGGATAAAAAAATGTGGCGGGG + Intergenic
1028823236 7:95237489-95237511 ATATATAAAAAAATATGGCTGGG - Intronic
1028829325 7:95310181-95310203 ATTTTTAAAAAGTTGAGGCCTGG - Intronic
1029890728 7:103926938-103926960 TTGTTTAAAAAGCTTAGGCTGGG - Intronic
1029909057 7:104124699-104124721 ATGACTAATGAGATGAGGCTTGG + Intergenic
1030550811 7:110957188-110957210 ATGTTGTAAAAGATGAGACTGGG - Intronic
1031998443 7:128248133-128248155 AAATACAAAAAAATGAGGCTGGG + Intronic
1032007440 7:128314260-128314282 ATTTATAAAGAAAAGAGGCTTGG - Intronic
1032346986 7:131125573-131125595 ATCCAAAAAAAGATCAGGCTAGG + Intronic
1032510138 7:132465887-132465909 TTTTAGAAAAAGAGGAGGCTAGG + Intronic
1032746587 7:134792585-134792607 CTTTATAAGAAGAGGAGGCTAGG - Intronic
1032773124 7:135079758-135079780 ATGTATAAAAAGATGAGGCTGGG - Intronic
1033249117 7:139743588-139743610 ATCTAGAAAAAAATGAGACTTGG + Intronic
1034302760 7:150030959-150030981 TTGTAAAAAAATCTGAGGCTGGG + Intergenic
1034803300 7:154066353-154066375 TTGTAAAAAAATCTGAGGCTGGG - Intronic
1035576073 8:706476-706498 ATATAAAAAAAGATAAGGCCAGG + Intronic
1036248503 8:7141424-7141446 CTATTTAAAAAGAAGAGGCTGGG + Intergenic
1036966694 8:13306786-13306808 ATGGATAAAAAGTAGAGGCTGGG + Intronic
1037853779 8:22354772-22354794 TCGTATAAAAACAGGAGGCTGGG + Intronic
1042056887 8:64773576-64773598 CAGTATAAGAAGATGAGGTTTGG - Intronic
1042336259 8:67632605-67632627 ACATATTAAAACATGAGGCTTGG - Intronic
1043190605 8:77217714-77217736 ATATTTATAAAAATGAGGCTTGG - Intergenic
1043244670 8:77982343-77982365 AGGCATGAAAAGCTGAGGCTAGG + Intergenic
1044583054 8:93841640-93841662 AGATTTAAAAAGATAAGGCTGGG + Intergenic
1044802442 8:95971167-95971189 AAGTATAACAAGATGAGCCATGG + Intergenic
1044964106 8:97558231-97558253 ATTTATAAGAACATGTGGCTGGG - Intergenic
1045021015 8:98044544-98044566 AGGTAAGAAAAGTTGAGGCTGGG - Intronic
1047004545 8:120606077-120606099 AAGTATAAATAGATCAGACTAGG + Intronic
1047312244 8:123701960-123701982 ATATATAGAAAGATGAAGATGGG - Intronic
1048107327 8:131425881-131425903 ATGCATGATAATATGAGGCTTGG - Intergenic
1048408691 8:134149640-134149662 ATGAATAAAAATTTGAGGCAGGG - Intergenic
1048460133 8:134614668-134614690 GTGTTCAAAAAGATGAAGCTAGG + Intronic
1049520920 8:143090163-143090185 ATTTAAAAAAAAATGAGGCAGGG + Intergenic
1050444946 9:5711141-5711163 ATATATAAAAAGAAGATCCTAGG + Intronic
1051530926 9:18102180-18102202 ATGTATGAAAAGATCAGCTTAGG - Intergenic
1051848319 9:21477930-21477952 ATTTAAAAAAAGAACAGGCTGGG - Intergenic
1052194147 9:25691821-25691843 ATGTTTAAAAAAATTAAGCTTGG - Intergenic
1052215949 9:25965438-25965460 TTGCATAATAAGATTAGGCTTGG - Intergenic
1052544604 9:29859495-29859517 ATGTATAAAAACCTGCAGCTAGG - Intergenic
1052624512 9:30957709-30957731 ATAAATAAAAAGATGAGATTTGG - Intergenic
1052937419 9:34104618-34104640 AAGTGTAAAAAAATGAGGCCAGG + Intronic
1052944865 9:34160204-34160226 ATTTTTTAAAAAATGAGGCTGGG - Intergenic
1053867775 9:42457832-42457854 TTGTATGAAAAGATCAGTCTGGG + Intergenic
1054892147 9:70262329-70262351 AAGTAGAAAAAGATGAAACTCGG + Intronic
1054919306 9:70526057-70526079 ATGTATAAAATGATGGGGCTGGG + Intergenic
1054960559 9:70963635-70963657 ATGTTTACAAAAATGAGGCTTGG + Intronic
1054984415 9:71245151-71245173 ATAAATACAAAGAAGAGGCTGGG + Intronic
1055379001 9:75685801-75685823 ATTTAAAAAAAGACGAGGATGGG + Intergenic
1055548375 9:77406710-77406732 AAAAAAAAAAAGATGAGGCTGGG - Intronic
1055779311 9:79802224-79802246 ATGTATAAATAGAGGAGGAAAGG - Intergenic
1056037353 9:82620669-82620691 AGGTCTGAAAAGATGAGGATTGG - Intergenic
1056174336 9:84019502-84019524 TTTTAAAAAAAGATTAGGCTGGG - Intergenic
1056797007 9:89665403-89665425 ATAAATAAATAAATGAGGCTAGG - Intergenic
1058140824 9:101355354-101355376 CTGTATCAAAAGAGGAAGCTTGG - Intergenic
1058463865 9:105209020-105209042 ACGTAAAAAATAATGAGGCTGGG + Intergenic
1058533870 9:105934336-105934358 GCCAATAAAAAGATGAGGCTGGG - Intergenic
1058872527 9:109214946-109214968 AGATATACAAAGATGAGGCAGGG + Intronic
1059511430 9:114851769-114851791 ATTTAAAAAAACCTGAGGCTGGG - Intergenic
1059663481 9:116424461-116424483 AAGTGTTAAAAGGTGAGGCTGGG - Intergenic
1060003611 9:119980626-119980648 ATGGGTAATAAGGTGAGGCTGGG + Intergenic
1061179704 9:129017466-129017488 AACAATAAAAATATGAGGCTGGG + Intronic
1061383342 9:130272856-130272878 ATGAATAAAAAGAAGATGCTCGG - Intergenic
1061555850 9:131368400-131368422 TGGTATAAAGAGATGGGGCTGGG + Intergenic
1062184859 9:135212768-135212790 ATGCATAAAAAGCTGTGGCTGGG - Intergenic
1185964531 X:4585845-4585867 CTTTATAAGAAGAGGAGGCTGGG + Intergenic
1185984345 X:4814374-4814396 ATGTATAAAAAGTGTAGACTGGG + Intergenic
1187349399 X:18498391-18498413 AGTAATAAAAAGATCAGGCTGGG - Intronic
1187720564 X:22146519-22146541 CTATATTAAAAGATGAGTCTGGG + Intronic
1188062010 X:25612546-25612568 AGGTATAAAAGGATGAGGAGAGG + Intergenic
1188550634 X:31360957-31360979 TTGTATTAAAAGGTGGGGCTGGG + Intronic
1188872494 X:35390095-35390117 GGGTGTAAAAAGATGAGTCTAGG + Intergenic
1189455331 X:41182642-41182664 ATGTTTAAAAAGGTGAGGGGAGG + Intronic
1189879671 X:45477225-45477247 ATATATAAAAAAATGAGAATTGG - Intergenic
1189924968 X:45943434-45943456 ACATATAAAAAGAAGAGGCTGGG - Intergenic
1190312631 X:49127860-49127882 ATGTATTTAAAGGTGAGGCACGG + Intergenic
1190487653 X:50943792-50943814 ATATTTAAACAGAAGAGGCTGGG - Intergenic
1190787009 X:53661327-53661349 TTTTAAAAAAAGGTGAGGCTGGG - Intronic
1190891059 X:54568260-54568282 ATTTATTAAAAGAATAGGCTGGG - Intergenic
1192050246 X:67718087-67718109 ATCTATAAAAAGGTGAGGTCAGG - Intronic
1193204580 X:78733267-78733289 ATCAATAAAAAGATGAATCTTGG - Intergenic
1193345475 X:80398479-80398501 ATGTTTCAAAACATGAGTCTGGG - Intronic
1193348575 X:80431557-80431579 ATTTACAAAAGGAAGAGGCTGGG + Intronic
1193511908 X:82412585-82412607 ATGAAAAAAAAAAAGAGGCTGGG - Intergenic
1193614658 X:83672286-83672308 AAATGTAAAAACATGAGGCTTGG + Intergenic
1194509140 X:94770827-94770849 CCCTAGAAAAAGATGAGGCTTGG - Intergenic
1194572641 X:95572755-95572777 ATGTATGGAAAGATGTGGCAGGG + Intergenic
1194585076 X:95722368-95722390 ATATATAAAAAGAAGAGATTCGG - Intergenic
1195516386 X:105780866-105780888 ATGCATAAAAATATGAGGTTTGG - Intergenic
1195640739 X:107172026-107172048 AGAAATAAAAAGATGAGGCCAGG + Intronic
1196648376 X:118143013-118143035 ATCTATAGAAAGTTCAGGCTGGG - Intergenic
1197580787 X:128281003-128281025 ATCTATAAAAAAAGGAGGCTGGG + Intergenic
1198155580 X:133956978-133957000 GTTTATAAAATGATGAGACTTGG - Intronic
1199109446 X:143912340-143912362 ATGAATTAAAAGTTGAGGCCGGG - Intergenic
1199592975 X:149485110-149485132 ACTTATAAAAAGATGAGGTCAGG + Intronic