ID: 1032773970

View in Genome Browser
Species Human (GRCh38)
Location 7:135090745-135090767
Sequence CCCTTAGGGTGGAGCTTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032773970_1032773978 -10 Left 1032773970 7:135090745-135090767 CCACCTAAGCTCCACCCTAAGGG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1032773978 7:135090758-135090780 ACCCTAAGGGTGAAAGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032773970 Original CRISPR CCCTTAGGGTGGAGCTTAGG TGG (reversed) Intronic
906717805 1:47983326-47983348 ACCTGAGCGTGGAGGTTAGGAGG + Intronic
907804484 1:57804579-57804601 ACATAAGGGTGCAGCTTAGGAGG - Intronic
910780116 1:90922733-90922755 CCTTAAGGGTGGAGGGTAGGAGG - Intronic
917263022 1:173190160-173190182 CCCTCAGGATGGAGCGTAGTGGG - Intronic
917808904 1:178638553-178638575 CCCTTTGGGAGGAGCCGAGGGGG - Intergenic
918786068 1:188765539-188765561 CTTTTAGGGTGGAGGGTAGGAGG - Intergenic
919191570 1:194227852-194227874 ACCTTAGGGTGGAGGGTGGGAGG + Intergenic
921424740 1:214988626-214988648 CCCTGAGGGTGGAGGTTGGGAGG - Intergenic
1063077955 10:2735211-2735233 AGCTCAGGGTGGATCTTAGGAGG + Intergenic
1066594506 10:37035191-37035213 CCTTAAGGGTGGAGGTTATGAGG + Intergenic
1071714180 10:88078322-88078344 CCCTTGGGGTGGGGGTTGGGTGG + Intergenic
1073247623 10:102102689-102102711 ACCTTAGGGTGGGGGTTAGGAGG + Intergenic
1074235007 10:111576333-111576355 CCCTTAGAGAGGAGCTTGGATGG + Intergenic
1075164810 10:120058150-120058172 CCCTAAGGGTGGAGGATGGGAGG + Intergenic
1075956183 10:126525062-126525084 CCCTTAGGGGGAAGCTGGGGTGG - Intronic
1083291942 11:61695424-61695446 CCCTTAGGCAGGAGCTTCTGGGG - Intronic
1083764508 11:64835561-64835583 CCCTGAGGGTGGGCCTCAGGAGG - Exonic
1084014573 11:66371164-66371186 CCCTTTGGATGAAGCTTAGCGGG - Intronic
1086823953 11:91472000-91472022 ACTTGAGGGTGGAGGTTAGGAGG - Intergenic
1087081146 11:94172193-94172215 CCATTAGGTTGGAGCTTCTGTGG + Intronic
1087703038 11:101458371-101458393 CATGTAGGGTAGAGCTTAGGAGG - Intronic
1088953600 11:114595792-114595814 TCCTTAAGGTGGAGCTGACGTGG - Intergenic
1089218063 11:116847736-116847758 CCCTTTGGGTGGTGCTTTAGAGG - Intronic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1096384884 12:51188727-51188749 CCCTCAGGGTGGATCATGGGAGG + Exonic
1096437336 12:51604992-51605014 ACTTTAGGGTGGACGTTAGGAGG - Intronic
1106048493 13:26168041-26168063 ACCTTAGGGTGGAGGGTGGGAGG + Intronic
1107703935 13:43080222-43080244 ACCTGAGGGTGGAGGGTAGGAGG - Intronic
1110707214 13:78609347-78609369 CCGTTCGGGTGGAGCTTGGGCGG + Intergenic
1113206028 13:107917032-107917054 ACCTGAGGGTGGAGAGTAGGAGG - Intergenic
1117310250 14:54514591-54514613 ACCTGAGGGTGGAAGTTAGGAGG - Intronic
1117383857 14:55191942-55191964 CCCTTAGGCTGGAGTATAGTGGG + Intergenic
1123149103 14:106164516-106164538 CCCTTTCCCTGGAGCTTAGGTGG - Intergenic
1125061635 15:35432853-35432875 ACTTGAGGGTGGAGGTTAGGAGG + Intronic
1128647653 15:69388871-69388893 CCCTTAGGGGAGACCTCAGGAGG + Intronic
1129240423 15:74248620-74248642 CCCTTAGTGGGGAGCTGAAGAGG + Intronic
1129834311 15:78692331-78692353 CCATTAGGGTGGGGGTGAGGGGG + Intronic
1132308335 15:100835183-100835205 CCTTGAGGGTGGAGGTTGGGAGG - Intergenic
1132382670 15:101377362-101377384 CCCCTAGGTAGGAGCTCAGGCGG - Intronic
1132547281 16:539178-539200 GCGTCAGGGTAGAGCTTAGGAGG - Intronic
1132655492 16:1040334-1040356 CCCTCAGGGGGGAACTTCGGGGG - Intergenic
1132933344 16:2469525-2469547 CCCTTAGGGTGGGGTGTCGGGGG + Intergenic
1136103287 16:28010961-28010983 GCCTGAGGGTAGAGCTGAGGAGG + Intronic
1136681116 16:31963041-31963063 CCCTTTCCCTGGAGCTTAGGTGG + Intergenic
1136781432 16:32904553-32904575 CCCTTTCCCTGGAGCTTAGGTGG + Intergenic
1136888365 16:33949287-33949309 CCCTTTCCCTGGAGCTTAGGTGG - Intergenic
1137374103 16:47937460-47937482 ACCTAAGGGTGGAGTTAAGGGGG - Intergenic
1138268153 16:55675327-55675349 CCCTGAGGGTGGAGTTCTGGTGG - Intronic
1138596087 16:58029725-58029747 CCCTTGGGGTGGGGCAAAGGAGG - Intronic
1139374280 16:66487089-66487111 CCCTCAGTGTGGAGCTCAGCTGG - Intronic
1141908123 16:87041050-87041072 CCCTCATGGTGGAGGGTAGGTGG - Intergenic
1142138296 16:88461354-88461376 CCCTGAGGGTGCAGCCCAGGTGG - Intronic
1203084084 16_KI270728v1_random:1168535-1168557 CCCTTTCCCTGGAGCTTAGGTGG + Intergenic
1142731879 17:1864653-1864675 TTCTTAGGCTGGACCTTAGGTGG + Intronic
1144483413 17:15645796-15645818 CACTGAGAGTGGAGCTGAGGGGG + Intronic
1146241099 17:31227134-31227156 CCTTTTGGGTGGAGCTTATCAGG + Intronic
1147863572 17:43538419-43538441 CCCTTAATGTGCAGCTAAGGAGG + Intronic
1148053005 17:44778297-44778319 CCCTACTGGTGGAGCTGAGGGGG + Intronic
1149062007 17:52433672-52433694 CCCTTAGCTTGGCCCTTAGGAGG + Intergenic
1150066987 17:62118837-62118859 ACTTGAGGGTGGAGCATAGGAGG + Intergenic
1156257255 18:35410101-35410123 CACCCAGGGTGGAGCTAAGGAGG - Intergenic
1159879338 18:73843891-73843913 CCCTTAGTGTGGGGATTTGGAGG - Intergenic
1164801247 19:31078602-31078624 ACCTTAGGGTGGAGATTGTGAGG + Intergenic
1166179128 19:41094809-41094831 CTCTGAGGGAGGAGCTTTGGGGG - Intronic
1168208780 19:54873303-54873325 CCTTTAGGGTGGAGGGTGGGAGG + Intergenic
932759220 2:74428622-74428644 CCCTCAGGGTGCAGGTGAGGGGG - Exonic
935944149 2:108270663-108270685 CCATCAGTTTGGAGCTTAGGCGG - Intergenic
937360076 2:121223582-121223604 CCCTTTGTGGGGAGGTTAGGGGG - Exonic
937470316 2:122168817-122168839 CCCTTAGTGTGGAGCCTAACAGG - Intergenic
938273804 2:129998467-129998489 CCCTGAGGGTGGAGCCAAGATGG + Intergenic
938442406 2:131347647-131347669 CCCTGAGGGTGGAGCGAAGACGG - Intronic
938981640 2:136532668-136532690 CCCTCAGGTGGGAGCTGAGGTGG + Intergenic
939111776 2:138017228-138017250 CCCTTAAGGTGGGGCTTGGATGG - Intergenic
942760703 2:179394199-179394221 ACCTGAGGGTGGAGGTTGGGAGG + Intergenic
1174150142 20:48480647-48480669 CCCACAGGGTGGAGCTGAGTGGG - Intergenic
1176918420 21:14655251-14655273 CACTTAGGGTGCAGCATAGAAGG + Intronic
1180783730 22:18535594-18535616 ACCTTAGGGTGGAGGTGGGGTGG + Intergenic
1181361264 22:22338858-22338880 TCCTTGGGGTGGAGAGTAGGGGG + Intergenic
1182419749 22:30243207-30243229 CCCTTAGGTTGGGACTTAGGTGG - Exonic
1183893604 22:40950756-40950778 GCCTTAGGGAGGAACTTCGGGGG + Intergenic
951599169 3:24354217-24354239 CCTTTTGGGTGGAGGATAGGAGG + Intronic
952450503 3:33427857-33427879 CCCCAAGGCAGGAGCTTAGGTGG - Intronic
954577508 3:51684677-51684699 CCCCTTGGGTGGAGCTGAGGAGG + Intronic
954762916 3:52890048-52890070 CCCTTAGCCTGGTGCTCAGGTGG + Intronic
955517079 3:59736756-59736778 ACCTTAGGGTGGAGCTTGGAGGG + Intergenic
955823938 3:62924992-62925014 CCTTTTGGGTGGAGCATAGGTGG + Intergenic
961247511 3:125468239-125468261 ACTTAAGGGTGGAGGTTAGGAGG + Intronic
961459177 3:127039380-127039402 CCCTGATGGTGGAGCTTTGGGGG + Intergenic
963078788 3:141372199-141372221 ACATTAGGATGGAGCTGAGGAGG + Intronic
963416159 3:144998591-144998613 ACCTTTGGATGGAGCTTTGGTGG + Intergenic
964193969 3:154040071-154040093 CCCTGAGGGTGGAGGTGGGGAGG + Intergenic
967744997 3:193045385-193045407 ACCTGAGGGTGGAGGGTAGGAGG + Intergenic
971413789 4:26403530-26403552 ACTTGAGGGTGGAGCTTGGGAGG - Intronic
973832990 4:54780619-54780641 CCTCTAGGGTGGACCTTTGGTGG + Intergenic
974302756 4:60090077-60090099 CCCTGAGGGTGGAGATAGGGAGG - Intergenic
977738473 4:100446736-100446758 ACCTGAGGGTGGAGGGTAGGAGG - Intronic
978949484 4:114540446-114540468 CCTTGAGGGTGGAGGGTAGGAGG - Intergenic
985239178 4:187911842-187911864 CCTTGAGGGTGGAGGTTGGGAGG - Intergenic
987306032 5:16638735-16638757 CCCTGAGGGTGGAGCCAAGGTGG - Intergenic
987667275 5:20959432-20959454 CCCTTACGGTGGAGTTAGGGTGG + Intergenic
987925565 5:24336531-24336553 CCATTAGGGTGGAGTTTGGGCGG + Intergenic
988966727 5:36426065-36426087 ACCTGAGGGTGGAGTTTTGGAGG - Intergenic
990707172 5:58542274-58542296 CCTGTAGGGTGGAGCCAAGGTGG - Exonic
993075505 5:83225548-83225570 CCCTTAGGTAGGAGCTATGGAGG + Intronic
996837914 5:127814396-127814418 CCCAGAGTGTGGAGCTCAGGAGG + Intergenic
996953809 5:129159723-129159745 ACCTGAGGGTGGAGGGTAGGAGG - Intergenic
999593668 5:153177854-153177876 ACCTGAGGGTGGAGGGTAGGAGG + Intergenic
999863915 5:155679671-155679693 GCTTAAGGGTGGAGCTTAGTTGG - Intergenic
1000407110 5:160899899-160899921 TCTTGAGGGTGGAGCTGAGGAGG - Intergenic
1003604497 6:7546973-7546995 TTCTTAGGGTGGAGCAAAGGAGG + Intronic
1006099705 6:31679021-31679043 GACTTGGGGTGCAGCTTAGGAGG + Intronic
1007377643 6:41467650-41467672 TCCTTGGGGTGGAGCTGGGGGGG + Intergenic
1007509833 6:42366465-42366487 CCGTTAGAGTGGATGTTAGGAGG - Intronic
1008972903 6:57390536-57390558 ACCTGAGGGTGGAGGTTGGGAGG - Intronic
1009161812 6:60292099-60292121 ACCTGAGGGTGGAGGTTGGGAGG - Intergenic
1012113850 6:95268512-95268534 CCCTGAGGGTGGAGCTTACTTGG - Intergenic
1015736273 6:136403129-136403151 CCATTAGGGTGGGGCTAAGTAGG - Intronic
1017218299 6:151936103-151936125 CCTTTACAGTGGAGCTTGGGAGG - Intronic
1017391931 6:153949720-153949742 TCCTAAGAGTGGAGCTAAGGAGG - Intergenic
1017769611 6:157634936-157634958 CCCTTCAGGTGGAGCATAGAGGG + Intronic
1019276647 7:179430-179452 TCCTTGGGAAGGAGCTTAGGCGG + Intergenic
1021606226 7:22412149-22412171 CCCTGAGGGTGAAGCCCAGGAGG + Intergenic
1022735889 7:33075706-33075728 CCCCTAGAGTGTAACTTAGGAGG + Intergenic
1024047518 7:45595306-45595328 CCCCTAGGGTGGGGCCCAGGGGG + Intronic
1032773970 7:135090745-135090767 CCCTTAGGGTGGAGCTTAGGTGG - Intronic
1032902396 7:136324276-136324298 ACCTCAGGGTGGAGGGTAGGGGG - Intergenic
1034313568 7:150110712-150110734 GCCTGAGGGTGGGGCTTAGAAGG + Intergenic
1034366655 7:150555530-150555552 ACCTTAGGGTGGAGGATGGGAGG + Intergenic
1034793328 7:153990084-153990106 GCCTGAGGGTGGGGCTTAGAAGG - Intronic
1035914114 8:3600029-3600051 CCCTTAGTGATGAGCTGAGGAGG - Intronic
1037787438 8:21911248-21911270 CCCTGGGGGTGAAGCTTAGATGG + Intronic
1038765160 8:30421240-30421262 CATCTAGGGTGGAGCTAAGGGGG + Intronic
1041771865 8:61480713-61480735 CCCTGAGGGTGGAGCCAAGATGG - Intronic
1042817550 8:72894252-72894274 CCCTAAGGGTGGAGCTCAGCAGG + Intronic
1047675730 8:127199170-127199192 ACCTGAGGGTGGAGGTTGGGAGG + Intergenic
1053316633 9:37057756-37057778 CACTTAGGCTGGAGTATAGGTGG + Intergenic
1053580870 9:39403155-39403177 ACATTAGGGTGGAGGATAGGAGG + Intergenic
1054102456 9:60961959-60961981 ACATTAGGGTGGAGGATAGGAGG + Intergenic
1054583902 9:66944910-66944932 ACATTAGGGTGGAGGATAGGAGG - Intergenic
1055369890 9:75586220-75586242 CCCTGAGGGTGGAGGGTGGGAGG + Intergenic
1056201396 9:84280326-84280348 CCCTTTGGATGAAACTTAGGAGG - Intronic
1061497390 9:130982775-130982797 TCCTTTGGGCGGAGCTCAGGAGG + Intergenic
1189573669 X:42326711-42326733 ACCTGAGGGTGGAGGTTAGGAGG + Intergenic
1189653602 X:43217074-43217096 ACTTGAGGGTGGAGGTTAGGAGG + Intergenic
1193634937 X:83938028-83938050 ATCTGAGGGTGGAGGTTAGGAGG - Intergenic
1194320193 X:92436811-92436833 CCTTGAGGGTGGAGTTTTGGAGG + Intronic
1195049155 X:101080882-101080904 TACTTAGGGTGCAGCTTGGGGGG - Intronic
1195989536 X:110668703-110668725 CCCCCAGGATGGAGCTTAAGCGG + Intergenic
1196844839 X:119889677-119889699 TCCTTCGTGTCGAGCTTAGGTGG - Intergenic
1197173632 X:123461906-123461928 CCTTTAGCTTGGAGGTTAGGTGG + Intronic
1200628315 Y:5549943-5549965 CCTTGAGGGTGGAGTTTTGGAGG + Intronic