ID: 1032774098

View in Genome Browser
Species Human (GRCh38)
Location 7:135091744-135091766
Sequence CAGTATGAGCAGAAGCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 698
Summary {0: 1, 1: 0, 2: 5, 3: 80, 4: 612}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032774098 Original CRISPR CAGTATGAGCAGAAGCAAGG AGG (reversed) Intronic
900037084 1:423261-423283 CAGCATGAGCAAATGCAAGGAGG + Intergenic
900058714 1:659002-659024 CAGCATGAGCAAATGCAAGGAGG + Intergenic
900818275 1:4867053-4867075 GAGTGTGAGCCGAAGCAGGGTGG - Intergenic
901614114 1:10524318-10524340 CAGTATGTGAAGAACCAAGAAGG + Intronic
902151442 1:14446544-14446566 CAGTATGAGCTAAACCATGGAGG + Intergenic
905265548 1:36752301-36752323 GAGAATGAGAAGAACCAAGGAGG - Intergenic
905575733 1:39043177-39043199 CAGTATGAGCAAAAGCATGGAGG + Intergenic
905600237 1:39243772-39243794 TAGTATGAGCAGAAGAGATGAGG + Intronic
906278169 1:44533821-44533843 CAGAATGAGCAAAAGCAGAGAGG + Intronic
906579634 1:46925692-46925714 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
906604089 1:47153196-47153218 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
906651808 1:47518082-47518104 GAGTGTGAGCAGAAGCTAAGAGG - Intergenic
906653161 1:47527840-47527862 CAGAATGAGCAGACTCTAGGGGG + Intergenic
906678951 1:47712025-47712047 CAGCATCAACAGAAGCAATGCGG + Intergenic
906714434 1:47956382-47956404 GAGCATGAGCTGAAGCAGGGCGG + Intronic
907005677 1:50910846-50910868 GAGTGTGAGCCGAAGCAGGGCGG - Intronic
907754088 1:57293074-57293096 CAGCATGTGTAAAAGCAAGGAGG + Intronic
907786339 1:57616807-57616829 AAGCATGACCAAAAGCAAGGTGG + Intronic
908592788 1:65651826-65651848 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
909448971 1:75777735-75777757 GAGGGTGAGCTGAAGCAAGGTGG + Intronic
909493209 1:76248105-76248127 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
910626852 1:89316477-89316499 GAGGGTGAGCAGAAGCAAGGTGG + Intergenic
910827916 1:91428731-91428753 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
910930295 1:92436730-92436752 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
911505314 1:98742056-98742078 CAGTATGAGCACAAAAAATGGGG + Intronic
912396792 1:109351505-109351527 TAGTATTAGCAAACGCAAGGAGG + Intronic
912565773 1:110586174-110586196 CAGGAGCAGAAGAAGCAAGGGGG - Intergenic
912894948 1:113576453-113576475 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
913102815 1:115584819-115584841 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
913113192 1:115674116-115674138 CAGTGTGAGCAGAAACAGGCTGG - Intronic
915061443 1:153188947-153188969 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
916251816 1:162746145-162746167 GAGTGTGAGCTGAAGCAGGGTGG + Intronic
916731678 1:167572196-167572218 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
917660597 1:177173516-177173538 CAGTGTGGGCACAAGAAAGGAGG + Intronic
917845304 1:179015376-179015398 CAGTATGAACAGAGACATGGAGG - Intergenic
917893786 1:179466086-179466108 GAGTGTGAGCTGAAGCAGGGCGG - Intronic
918163278 1:181920580-181920602 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
919491039 1:198205040-198205062 AAGTAGGAGAAGAAGGAAGGGGG - Intronic
919782629 1:201230703-201230725 CACCATGAGCAAAGGCAAGGAGG + Intergenic
920125882 1:203693370-203693392 CAGTATGCCCTGCAGCAAGGCGG - Intronic
920781047 1:208991599-208991621 GAGTGTGAGCCGAAGCAGGGTGG + Intergenic
920985508 1:210885255-210885277 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
921546507 1:216481231-216481253 CGGTATGAGCATAACAAAGGTGG - Intergenic
921631261 1:217437077-217437099 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
922050348 1:221983426-221983448 CAGCATGAGCAAAGGCATGGAGG - Intergenic
922066129 1:222145642-222145664 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
922715928 1:227872034-227872056 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
923194501 1:231652061-231652083 CAGGGTGAGCCGAAGCAGGGCGG - Intronic
923199731 1:231699662-231699684 TAGTAAGAGCAGAAGAAGGGAGG - Intronic
923550498 1:234959382-234959404 CTGGATGAGCAGTAGCAAGGAGG - Intergenic
923853345 1:237820368-237820390 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
924035463 1:239931680-239931702 AAGTATGAACAGAAGCATGTGGG - Intergenic
1063779056 10:9300153-9300175 CAGTATGTGCAGAAGCATGTAGG + Intergenic
1064102136 10:12472988-12473010 CAGGATGAGCAGAAACACAGAGG + Intronic
1066000893 10:31103295-31103317 TAGTAGCAGCAGATGCAAGGAGG + Intergenic
1066162959 10:32754794-32754816 GAGTGTGAGCTGAAGCAGGGCGG + Intronic
1066176415 10:32912318-32912340 GAGTGTGAGCCGAAGCAGGGCGG + Intronic
1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG + Intergenic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1067929352 10:50544728-50544750 CAGTATAAACAGGAGCCAGGTGG + Intronic
1068357188 10:55923806-55923828 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1068453612 10:57226407-57226429 CAGGAAGAGCAGAAGTAGGGAGG + Intergenic
1068478008 10:57552244-57552266 GAGTGTGAGCCGAAGCAGGGTGG - Intergenic
1068575076 10:58675980-58676002 GAGAGTGAGCAGAAGCAGGGTGG + Intronic
1069351052 10:67527950-67527972 CAGAATGAGCAGGAGCATTGTGG - Intronic
1069355944 10:67585031-67585053 GAGTGTGAGCTGAAGCAGGGCGG - Intronic
1069610010 10:69766648-69766670 CAGTGGGAGCAGAAGCCATGGGG - Intergenic
1069993712 10:72329926-72329948 CAGCATGAGCAGAGGCCCGGAGG - Intergenic
1070213086 10:74347277-74347299 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1070843649 10:79505200-79505222 CAGCGTGAGCAGGAGCATGGAGG - Intergenic
1070930017 10:80254400-80254422 CAGCGTGAGCAGGAGCATGGAGG + Intergenic
1070950647 10:80428320-80428342 CAGTGTCAGCAGAGGCCAGGAGG + Intronic
1072493788 10:95934683-95934705 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1072709169 10:97704652-97704674 CAATGTGACCAGAAGCATGGTGG + Intergenic
1073139775 10:101239380-101239402 CAGTTTGGGCAGAACCCAGGAGG + Intergenic
1073978070 10:109122860-109122882 CAGATAGAGCAGAAGCATGGTGG + Intergenic
1074015463 10:109529867-109529889 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1074671676 10:115798615-115798637 CAGGATGAGCAAAGGCATGGAGG - Intronic
1074795594 10:116939461-116939483 AAGGGTGAGCTGAAGCAAGGTGG - Intronic
1075175387 10:120155855-120155877 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1075370763 10:121932939-121932961 TTGTATGAGCAGAGGCAGGGAGG + Intergenic
1075696113 10:124436729-124436751 CAGAATGAGATGAAGGAAGGAGG - Intergenic
1076108139 10:127840796-127840818 CAGGATGAGCGGGAGGAAGGTGG + Intergenic
1076963810 11:61183-61205 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1077995314 11:7447449-7447471 CAGCATGAGCAAAAGCAAAGTGG - Intronic
1078570372 11:12452690-12452712 CCGAATGAGCAGAAACAAGCAGG + Intronic
1078743803 11:14091975-14091997 GAGGATGAGCAGAAACAAGGTGG - Intronic
1079453155 11:20615015-20615037 CAGTAGGAGCAGAATCATTGCGG + Intronic
1079463742 11:20708309-20708331 GAGTGTGAGCCGAAGCAGGGCGG - Intronic
1079769602 11:24443313-24443335 TATCATGAGCACAAGCAAGGGGG - Intergenic
1079867821 11:25758137-25758159 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080709982 11:34737670-34737692 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080794533 11:35551258-35551280 CTGAATGATCAGAAGCAAGATGG + Intergenic
1080818231 11:35779410-35779432 GAGTGTGAGCTGAAGCAGGGTGG - Intronic
1080917350 11:36673564-36673586 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
1081118198 11:39231917-39231939 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1081269284 11:41064767-41064789 CAGAGGGAGCAGAAGCAGGGTGG + Intronic
1081587453 11:44397130-44397152 GAGTGTGAGCCGAAGCAGGGTGG - Intergenic
1082867161 11:57910713-57910735 CAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1082872225 11:57953829-57953851 GAGGTTGAGCAGAAGCAGGGTGG - Intergenic
1082876400 11:57992971-57992993 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1082945806 11:58757911-58757933 TAGTATGGGCACAATCAAGGTGG - Intergenic
1083880049 11:65543883-65543905 CTGCATGAGCAGAAGAAAGTGGG - Intronic
1083979996 11:66159466-66159488 GAGTATGTGCATATGCAAGGTGG + Intronic
1084943669 11:72627498-72627520 CAGTGTGAGCAAAGGCAGGGAGG + Intronic
1085395345 11:76204421-76204443 CAGCACGAGCAGAAGCCTGGAGG - Intronic
1085717148 11:78882358-78882380 CAGCATGGGCAAAAGCATGGTGG - Intronic
1086056116 11:82649065-82649087 AAGAAGGAGCAGAAGAAAGGAGG - Intergenic
1086150074 11:83599369-83599391 CTGGATAAGCAAAAGCAAGGAGG - Intronic
1086221494 11:84450434-84450456 CAGCAGGAGCAAAAGCAAGAAGG + Intronic
1086763668 11:90666781-90666803 CAGTATGAGAAGGAGTAATGAGG + Intergenic
1086812073 11:91322271-91322293 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1086923878 11:92618445-92618467 GAGTGTGAGCCGAAGCAGGGCGG - Intronic
1088003801 11:104916024-104916046 CAGTGTGAGAAGAAGCAAAAAGG + Intergenic
1088078379 11:105879186-105879208 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1088542196 11:110924753-110924775 GATTGGGAGCAGAAGCAAGGTGG - Intergenic
1089871881 11:121682247-121682269 CAGCATCAGCAGAAGTAAGCAGG + Intergenic
1090811620 11:130249640-130249662 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1091951521 12:4596865-4596887 CAGAATGCCCAGGAGCAAGGAGG + Intronic
1092064601 12:5579466-5579488 CAGTGTGAGCAAAAGCATGGTGG + Intronic
1092398876 12:8154208-8154230 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1092440320 12:8495749-8495771 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1092637479 12:10467195-10467217 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1092711313 12:11340388-11340410 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1093082181 12:14825268-14825290 CAGTATTTCCAGAAGCCAGGAGG - Intronic
1093608165 12:21119737-21119759 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1095595218 12:43950995-43951017 GAGAGTGAGCAGAAGCAGGGTGG + Intronic
1095920699 12:47526870-47526892 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1096571880 12:52528117-52528139 CAGTATCACCAAAAGCAACGAGG - Intergenic
1096788076 12:54029220-54029242 CAGTCTGAGGAGAAGGGAGGGGG + Intronic
1097654516 12:62343692-62343714 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1098193688 12:67977208-67977230 GAGAATGAGCAGAAGCGAGGTGG - Intergenic
1098706810 12:73702165-73702187 GAGTGTGAGCAGAAGCAGGGTGG + Intergenic
1099022610 12:77424846-77424868 GAGGATGAGCCGAAGCAGGGTGG - Intergenic
1099071449 12:78049504-78049526 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1099253801 12:80290186-80290208 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
1099965483 12:89440795-89440817 GAGCATGAGCCGAAGCAGGGCGG + Intronic
1100691081 12:97039039-97039061 AAGTATGAGAAGGAGCAGGGAGG + Intergenic
1100743298 12:97618868-97618890 CAGTAGGAGCAAAGTCAAGGAGG - Intergenic
1100965698 12:100010900-100010922 GAGTGTGAGCTGAAGCAGGGCGG + Intergenic
1103169238 12:118799447-118799469 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1103809633 12:123603028-123603050 TAGTTTGAGCAGCAGAAAGGAGG + Intronic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1104703002 12:130921440-130921462 AAGTGGGAGCAGAAGGAAGGGGG + Intergenic
1104816329 12:131648044-131648066 CACATTGAGGAGAAGCAAGGAGG - Intergenic
1105602976 13:21903379-21903401 CAGTATGTGCAGAGGCCGGGGGG - Intergenic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1106429339 13:29665429-29665451 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1107305606 13:39015007-39015029 CAGTATGAGCAAATGTATGGGGG - Intronic
1107632736 13:42358694-42358716 CAGTACTAGCAGAAGCCATGTGG - Intergenic
1107730933 13:43348074-43348096 CAGCATGAGCAGATGCAGGGAGG - Intronic
1108850197 13:54718706-54718728 GAGGACGAGCAGAAGCAGGGTGG - Intergenic
1108940488 13:55947500-55947522 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1109457570 13:62612017-62612039 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1110252565 13:73396944-73396966 CAGTATCAGCCGAACCAAGAAGG + Intergenic
1110824598 13:79957955-79957977 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1111057520 13:82971057-82971079 CAGAATGAGCAGTAGAAAAGGGG - Intergenic
1111627873 13:90813046-90813068 CAGGATGAGCAAAAGCAGGGTGG + Intergenic
1112685327 13:101818421-101818443 GAGAATTAGCAGAAGCTAGGAGG - Intronic
1113383079 13:109821272-109821294 CAGGAAGAGCAGATGCAGGGAGG - Intergenic
1113383871 13:109829344-109829366 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1113463927 13:110501007-110501029 CAGTATGAGCTGCAGCAAGAAGG + Intronic
1113488058 13:110669736-110669758 GAGTGTGAGCCGAAGCAGGGTGG + Intronic
1114578142 14:23731662-23731684 CTTTATGAGCAGAAGAAAGAAGG - Intergenic
1114677563 14:24453874-24453896 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1114695561 14:24624010-24624032 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1114844817 14:26308758-26308780 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1115357083 14:32460429-32460451 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1115912249 14:38269255-38269277 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1115974491 14:38981488-38981510 GAGGGCGAGCAGAAGCAAGGTGG - Intergenic
1116272848 14:42794770-42794792 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116565323 14:46438329-46438351 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116634410 14:47377388-47377410 GAGTGTGAGCCGAAGCAGGGTGG + Intronic
1117120976 14:52568149-52568171 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1117172312 14:53113581-53113603 GAGAGTGAGCAGAAGCATGGTGG + Intronic
1117186725 14:53247291-53247313 CAGTATATGCAAAAGCACGGAGG + Intergenic
1117511329 14:56454612-56454634 GAGTGTGAGCCGAAGCAGGGTGG + Intergenic
1117850145 14:59958904-59958926 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1118641112 14:67793478-67793500 CAGAAGAAGCAGAAGCAAGAGGG - Intronic
1119147008 14:72326529-72326551 TGGTAGGAGCAGAAGCAAGGAGG - Intronic
1120478962 14:85024318-85024340 CAGTGTGAGCCGAAGCAGGGCGG - Intergenic
1120624964 14:86813768-86813790 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1120970802 14:90205354-90205376 AAGTATGAGAAAAAGCAGGGAGG + Intergenic
1121108953 14:91299404-91299426 CAGTAGGAGCTGAAACAAGAAGG + Intronic
1121267006 14:92610713-92610735 CAGCATGAGCAGAGGCAAGGAGG + Intronic
1121602219 14:95213766-95213788 CAGGATGAGCAGAAGCAATGGGG - Intronic
1121692131 14:95885550-95885572 AAGTGTGAGCAGAAGCACAGAGG + Intergenic
1122356101 14:101123892-101123914 CAGGATGCGCAGAGCCAAGGGGG + Intergenic
1124047252 15:26161707-26161729 CAGTACCAGCAGGAGGAAGGTGG - Intergenic
1124396067 15:29303020-29303042 CAGTCTGAGCAGACTCAAAGGGG + Intronic
1125795898 15:42403690-42403712 CAGTGTCACCAGAAGCAAGCAGG - Intronic
1126735427 15:51727709-51727731 CAGTATGTACAGAAGCCAGGGGG - Intronic
1128325910 15:66724032-66724054 CAGCTTGTGCAAAAGCAAGGAGG + Intronic
1128342413 15:66831726-66831748 GAATGTGAGCAGAAGCAAGCAGG + Intergenic
1128354918 15:66919354-66919376 CAGCCTGAGCAGGGGCAAGGAGG + Intergenic
1128463366 15:67888276-67888298 CAGAATGAGCAAAAGCCTGGAGG + Intergenic
1128857595 15:71032273-71032295 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1129320097 15:74769953-74769975 AAGTGAAAGCAGAAGCAAGGGGG - Intergenic
1129355221 15:74986356-74986378 CCGCATGAGCAAAAGCAAGGAGG + Intronic
1129825464 15:78631983-78632005 CAGTGTGTGCAGGAGCAAAGAGG - Intronic
1131225844 15:90623888-90623910 CAGCATGCGCAAAAGCAGGGAGG - Intronic
1131956486 15:97741300-97741322 CAGTATTAGAAGAAGCAATGGGG + Intergenic
1132444743 15:101903990-101904012 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1133107311 16:3520889-3520911 GAGAAAGAGCAGAAGCATGGGGG - Intronic
1136600603 16:31284690-31284712 GAGTATGAGCCAAAGCAGGGTGG - Intronic
1136686704 16:31999156-31999178 CAGCATGTGCAGAAACAGGGTGG + Intergenic
1136731506 16:32417773-32417795 GAGGGTGAGCTGAAGCAAGGTGG - Intergenic
1136787316 16:32942693-32942715 CAGCATGTGCAGAAACAGGGTGG + Intergenic
1136882460 16:33911089-33911111 CAGCATGTGCAGAAACAGGGTGG - Intergenic
1137462788 16:48680529-48680551 CATTGGGAGCAGAAGGAAGGTGG - Intergenic
1137525079 16:49228245-49228267 GAGCATGAGCCGAAGCAGGGTGG + Intergenic
1138151468 16:54661507-54661529 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1138706824 16:58923600-58923622 CAGCAGGATCAGAAGAAAGGGGG + Intergenic
1138733999 16:59229813-59229835 GAGTGTGAGCCGAAGCAAGGCGG + Intergenic
1138799673 16:60012812-60012834 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1138886830 16:61090613-61090635 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1139405263 16:66712829-66712851 CAGTATTAGCCCAAGCAGGGTGG - Intergenic
1139872784 16:70120829-70120851 TAGCATGAGAAGAAGCAAGGTGG + Intronic
1140362992 16:74360501-74360523 TAGCATGAGAAGAAGCAAGGTGG - Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141562274 16:84877417-84877439 CACTGTGAACAGGAGCAAGGGGG - Exonic
1141756777 16:85996730-85996752 CAGTAAGAGAGGAAGGAAGGAGG + Intergenic
1142346594 16:89557978-89558000 CAGGGAGGGCAGAAGCAAGGGGG - Intergenic
1203089550 16_KI270728v1_random:1204365-1204387 CAGCATGTGCAGAAACAGGGTGG + Intergenic
1143338218 17:6189446-6189468 CAGCATGTGCAGAATCAAAGAGG - Intergenic
1143427225 17:6849497-6849519 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1143951391 17:10635478-10635500 CAGTATGAGGAGGAGCAGGAAGG - Exonic
1145099580 17:20063165-20063187 CAATATGAGCTAAAGCAATGAGG - Intronic
1145819119 17:27817783-27817805 CAATATGTGCAGAAGGAAGGAGG + Intronic
1145960874 17:28885944-28885966 CAGTCTGAGGAGCAGCCAGGGGG + Intronic
1146643296 17:34557117-34557139 CAGTATTTGCAGAAGCTGGGAGG + Intergenic
1146729820 17:35183698-35183720 CAGTAGGAACAGAAGCCTGGGGG - Intronic
1147938710 17:44029734-44029756 CAGTGGCAGCGGAAGCAAGGAGG - Intergenic
1148255603 17:46128910-46128932 CAGTAACTTCAGAAGCAAGGAGG + Intronic
1148682736 17:49484085-49484107 GAGTTAGAGCAGAAGAAAGGAGG - Intergenic
1149281358 17:55108703-55108725 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1150470052 17:65429564-65429586 CAATAATAGCAAAAGCAAGGAGG + Intergenic
1150772027 17:68050365-68050387 CAGAAAGAGAAGAAGGAAGGAGG - Intergenic
1150802839 17:68295210-68295232 CAGCATGAGAAGAAGGTAGGAGG + Intronic
1151574761 17:74947210-74947232 CAGGATGAGCAGCAGCGAGTAGG - Exonic
1151727559 17:75893567-75893589 CGGGAGGAGCAGAAACAAGGTGG - Intronic
1153119114 18:1700113-1700135 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1153217238 18:2832098-2832120 CAGTGTGAGCTGAAACAAGAAGG - Intergenic
1154107961 18:11540525-11540547 CAGTATGAGGCCAAGCACGGTGG + Intergenic
1154401622 18:14043552-14043574 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1155659333 18:28228969-28228991 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
1156011655 18:32503601-32503623 CAGTAGGAGCAGATGCCAGATGG - Intergenic
1156434420 18:37111698-37111720 GAGTATGAGCCAAAGCAGGGTGG + Intronic
1157469129 18:47974670-47974692 CAGCAACAGCAGAAGCAAGAAGG + Intergenic
1157556607 18:48616881-48616903 CAGTGTGAGCAAAAGCACAGAGG + Intronic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158832782 18:61298377-61298399 CAAGAGGAGAAGAAGCAAGGAGG + Intergenic
1159354222 18:67316327-67316349 CAGTAAGAGGAGCAGAAAGGAGG - Intergenic
1159570421 18:70105462-70105484 GACTGTGAGCAGAAGCAGGGCGG - Intronic
1159581237 18:70236565-70236587 GAGGGTGAGCAGAAGCAAGGTGG + Intergenic
1159942476 18:74418895-74418917 CAGCATGTGAAGAGGCAAGGAGG + Intergenic
1160640613 19:130814-130836 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1160756737 19:761432-761454 CAGCATGAGGAACAGCAAGGGGG + Intronic
1161619261 19:5289764-5289786 CAGCATGAGGAAGAGCAAGGGGG + Intronic
1161637209 19:5396437-5396459 CAGTATAAGCAAAGGCTAGGAGG + Intergenic
1161746102 19:6061128-6061150 CAGCAGGAGCGGAAGGAAGGGGG - Intronic
1161791534 19:6362737-6362759 CAGTATGTGCAGGATCAAAGAGG - Intronic
1162265126 19:9566748-9566770 CTCTATGAACAGAAGCAATGTGG - Exonic
1162904672 19:13816713-13816735 CACCATGAGCAGCAGCCAGGAGG + Intronic
1163502360 19:17684179-17684201 CAGCATGAGCAAAAGCATGGTGG - Intronic
1163779639 19:19239663-19239685 CAGGATGAGGAGCAGAAAGGAGG - Intronic
1163989799 19:20988043-20988065 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1164091494 19:21956802-21956824 GAGTGTGAGCCGAAGCAGGGTGG - Intronic
1166627482 19:44372071-44372093 CAGAATGAGCTGTAGGAAGGTGG - Intronic
925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG + Intergenic
926417043 2:12659847-12659869 CAGAATGAGCAGAAACAGGTTGG - Intergenic
927096507 2:19751327-19751349 CAGCATGAGCAAAGGCGAGGTGG + Intergenic
927099861 2:19779843-19779865 GAGTATGAGGACAACCAAGGGGG + Intergenic
927182715 2:20458450-20458472 GAGGGTGAGCAGAAGCAAGATGG + Intergenic
928504943 2:31941223-31941245 GTGTTTGAGGAGAAGCAAGGAGG - Intronic
929828528 2:45329212-45329234 CAGTATTAGCAAAGGCATGGAGG - Intergenic
930343112 2:50142834-50142856 CAGACTGAGCAAAAGCAAGAAGG + Intronic
930908959 2:56606797-56606819 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
930951248 2:57146391-57146413 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
930994870 2:57704314-57704336 CAGTATTAGCAGACACAAAGTGG - Intergenic
931558434 2:63530865-63530887 CAGTGTGAGCCAAAGCAAGGCGG + Intronic
932446616 2:71785687-71785709 CAGGAGGGGCAGAAGAAAGGCGG - Intergenic
932662717 2:73670467-73670489 GAGTGTGAGCCGAAGCAGGGTGG - Intergenic
933269321 2:80216226-80216248 CAGTGTGAGCCGAAGCAGGGCGG - Intronic
935982724 2:108643343-108643365 GAGGATGAGCCGAAGCAGGGTGG + Intronic
936616433 2:114052510-114052532 TAGTATAAGCAATAGCAAGGGGG - Intergenic
936859578 2:117001291-117001313 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
936900037 2:117472340-117472362 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
937084551 2:119162022-119162044 CAGGAGGAGCAGAAGCCAGGTGG - Intergenic
937465104 2:122125442-122125464 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
937497392 2:122435689-122435711 CAATATGAGAAAAAGCAAGGAGG - Intergenic
937562644 2:123244619-123244641 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
937653515 2:124347490-124347512 CAGATTGAGCAGAAGAAAGCTGG + Intronic
938144658 2:128823534-128823556 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
938146510 2:128839046-128839068 CAGTGAGAGGACAAGCAAGGAGG - Intergenic
938163625 2:129008190-129008212 CAGCAGGAGCAGGAGCATGGTGG - Intergenic
938224357 2:129602877-129602899 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
938244604 2:129766874-129766896 CAGGATGAGATGAAGCAACGAGG + Intergenic
938546023 2:132332490-132332512 CAGAATGAGCTGCAGGAAGGCGG + Intergenic
939180306 2:138795794-138795816 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
939744512 2:145952173-145952195 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
940030639 2:149257941-149257963 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
940400633 2:153244499-153244521 GAGTGTGAGCAGAAGCAGGGTGG + Intergenic
940644478 2:156376226-156376248 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
940827823 2:158433650-158433672 AAGTGTGAGCTGAAGCATGGTGG + Intronic
940995800 2:160148620-160148642 GAGGGTGAGCAGAAGCAGGGCGG + Intronic
941682420 2:168413339-168413361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
942431380 2:175914596-175914618 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
942519451 2:176788057-176788079 CAGTATAAACAGAAGCCAGCAGG - Intergenic
942655334 2:178208988-178209010 CAGTAAGTTCAGAAGCTAGGGGG - Intronic
943240465 2:185377314-185377336 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
943687059 2:190829752-190829774 GAGTAGGAGCAGGAGCAAGAGGG + Intergenic
943735468 2:191348979-191349001 AAGTATCAGCAGAAGTCAGGTGG - Intronic
943797949 2:192021795-192021817 CTGTGTGAGCTGAAGTAAGGAGG + Intronic
944267820 2:197748093-197748115 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
945210968 2:207381467-207381489 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
945418831 2:209608850-209608872 AAGAAAGAGCAGAAGCAAAGGGG - Intronic
946235252 2:218320737-218320759 CAGTATGTGCAAAGGCATGGGGG + Intronic
946536968 2:220641193-220641215 CAGAAACAGCAGAAGCAAGAAGG + Intergenic
946591520 2:221254504-221254526 GAGTATGTGCAGATGCAGGGAGG + Intergenic
946912904 2:224484978-224485000 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
947033424 2:225824398-225824420 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
947194414 2:227546456-227546478 GAGTGTGAGCCGAAGCAAGGCGG - Intronic
948006852 2:234616804-234616826 CAGTAGCAGCAGAAGCGAGGAGG + Intergenic
1168869406 20:1115677-1115699 CAGTATGTGCAAAGGCATGGTGG - Intronic
1169518205 20:6341375-6341397 CAGTTTAAGCAGAAACAAGTTGG + Intergenic
1169659113 20:7958509-7958531 GAGTGTGAGCCGAAGCAGGGTGG - Intergenic
1169745817 20:8941655-8941677 CAGTAGGAACAAATGCAAGGTGG + Intronic
1171286553 20:23943987-23944009 CATTATGTGCAAAAGCAAGAGGG - Intergenic
1171322699 20:24260415-24260437 CAGTATGGGGAGAAGAAAGATGG - Intergenic
1171874886 20:30565223-30565245 CAGAATGAGCTGCAGGAAGGCGG + Intergenic
1172121542 20:32601857-32601879 CAGTATGAGCTGAGGCCAGTGGG + Intronic
1172456334 20:35077229-35077251 GAGTGTGAGCTGAAGCAGGGCGG - Intronic
1172808235 20:37628648-37628670 CAGCATGTGCAAATGCAAGGAGG - Intergenic
1173080935 20:39866776-39866798 CAGTGTGAGAAACAGCAAGGAGG + Intergenic
1173094824 20:40015409-40015431 CAGTCTGAACAGATGAAAGGGGG + Intergenic
1173227191 20:41168842-41168864 CAGAATGTGGAGAAGCAAGAGGG + Exonic
1173361569 20:42349336-42349358 CAGTGTGAGCACAGGCATGGAGG - Intronic
1173596485 20:44261910-44261932 TAGTATGAGCAGAAGCCTGGAGG + Intronic
1174123498 20:48285631-48285653 CAGTGGGAGAGGAAGCAAGGCGG + Intergenic
1176933231 21:14838909-14838931 CTGTAAGACCAGAAGGAAGGTGG + Intergenic
1177278943 21:18952602-18952624 CAGTAAGAGCAGCAGCCAGGTGG - Intergenic
1177937776 21:27370506-27370528 CAGCATTAGGGGAAGCAAGGTGG + Intergenic
1178126893 21:29525970-29525992 CACTATCATGAGAAGCAAGGGGG + Intronic
1181494309 22:23279406-23279428 CAGTGGGACCAGGAGCAAGGAGG - Intronic
1181746648 22:24959697-24959719 CTGTACGAGAAGAAGGAAGGGGG + Intronic
1181817284 22:25448104-25448126 CAGAATGAGAAGAAGGAAAGCGG + Intergenic
1181845044 22:25700040-25700062 GTGTTTCAGCAGAAGCAAGGGGG - Intronic
1182037582 22:27211259-27211281 TGGTGTGAGCAGAATCAAGGAGG + Intergenic
1183174427 22:36212499-36212521 CTGTAAGTGCAGCAGCAAGGAGG - Intergenic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
1185282931 22:49983425-49983447 CAGTAAAAGCTGAAGCGAGGGGG + Intergenic
1185309687 22:50147196-50147218 CACTCTGTGCAGAAGCAGGGAGG + Intronic
949456671 3:4246232-4246254 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
949632613 3:5944545-5944567 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
949777324 3:7647487-7647509 CAGATTGTGCAGAAGCAAAGTGG + Intronic
949944105 3:9176703-9176725 CTGTAAAAGCAGAAGCAAGTGGG + Intronic
950058585 3:10049922-10049944 GAGTTTGAGCAGAAGCAAACTGG + Intronic
950300345 3:11871845-11871867 GAGTTTGAGCAGAAGCAAACTGG + Intergenic
951006261 3:17618873-17618895 GAGGGTGAGCTGAAGCAAGGCGG - Intronic
951135879 3:19103707-19103729 GAGGATGAGCAGAATCAGGGTGG - Intergenic
951254582 3:20433409-20433431 GAGGACGAGCAGAAGCAGGGTGG - Intergenic
951368256 3:21812372-21812394 GAGTGTGAGCTGAAGCAGGGCGG + Intronic
951469145 3:23036404-23036426 GAGCATGAGCCGAAGCAGGGTGG - Intergenic
951676521 3:25247616-25247638 GAGGATGAGCAGAAGCAGGGTGG - Intronic
951741600 3:25931326-25931348 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
951826584 3:26875657-26875679 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
952253292 3:31674651-31674673 TGGCAAGAGCAGAAGCAAGGTGG - Intronic
952608152 3:35174102-35174124 AAGAGTGAGCAGAAGCAGGGTGG - Intergenic
953555867 3:43946353-43946375 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
954280353 3:49572868-49572890 CTGTGTGTGCAGAAGAAAGGAGG + Intronic
956048384 3:65220701-65220723 GAGGATGAGCGGAAGCAGGGTGG - Intergenic
956220001 3:66892872-66892894 GAGGGTGAGCAGAAGCCAGGTGG + Intergenic
956373287 3:68587116-68587138 GAGGGTGAGCTGAAGCAAGGCGG - Intergenic
956745619 3:72308791-72308813 TACTGTGAGCAGATGCAAGGAGG + Intergenic
958479685 3:94630772-94630794 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
959453689 3:106533909-106533931 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
959598083 3:108149328-108149350 CAGCAAAAGCAGGAGCAAGGAGG - Intergenic
959894827 3:111593997-111594019 CAGCACGAGCAGGAGCTAGGTGG + Exonic
960525773 3:118708119-118708141 CAGTAAGTGAAGAAGCTAGGAGG - Intergenic
960721971 3:120633268-120633290 CACTATGAGGCAAAGCAAGGTGG - Exonic
960760163 3:121064267-121064289 GAGGAGGAGCAGAAGCAGGGTGG - Intronic
960773236 3:121217477-121217499 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
961671437 3:128534533-128534555 CAGTGGGAGCAGAATCCAGGTGG + Intergenic
961672864 3:128547638-128547660 CAGTCTCAACAGGAGCAAGGCGG + Intergenic
962156763 3:132956549-132956571 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
962338305 3:134558740-134558762 TAGTATGAGCTGAAGCCAAGTGG - Intronic
962642438 3:137401115-137401137 GAGGGTGAGCAGAAGCAAGGTGG - Intergenic
963043137 3:141083603-141083625 CAGCACAAGCAGAAGCATGGAGG - Intronic
963306816 3:143662475-143662497 GAGTGTGAGCTGAAGCAGGGCGG + Intronic
963442399 3:145356484-145356506 CAGTATGAACAGCAGAAAGAGGG - Intergenic
964391325 3:156201110-156201132 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
966230863 3:177650294-177650316 AAGTATAATCAAAAGCAAGGTGG + Intergenic
966305131 3:178523165-178523187 CAGCATGAGCACAAGCAGAGAGG + Intronic
966310935 3:178593021-178593043 AAGTACGAGCAGAGGGAAGGGGG + Intronic
968376078 4:42519-42541 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
969045235 4:4331742-4331764 CAGGATGAGATGAAGCCAGGGGG + Intergenic
969238548 4:5885178-5885200 CAGCATGGGCAAAGGCAAGGAGG - Intronic
969320820 4:6411396-6411418 CAGCAGGAGCAGCAGGAAGGAGG + Intronic
969542417 4:7801255-7801277 CAGTTTGAGGAGCAGGAAGGCGG - Intronic
969631791 4:8343254-8343276 CTGGATGAGGAGAAGCAGGGAGG + Intergenic
970098247 4:12489355-12489377 CAGTAACAGCATAAGCATGGAGG - Intergenic
970214605 4:13745665-13745687 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
970864060 4:20738765-20738787 GAGTGTGAGCCGAAGCAGGGTGG + Intronic
970915776 4:21332759-21332781 CAGCAGGATCAGAAACAAGGAGG - Intronic
971222217 4:24718734-24718756 CAGTTGAAGCAGAAGCAAGAGGG + Intergenic
972797632 4:42437882-42437904 CAGAATGAGCGGAAGCAAAAGGG + Intronic
973272920 4:48279759-48279781 GAGGGTGAGCTGAAGCAAGGTGG + Intergenic
973626118 4:52774128-52774150 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
975076332 4:70213192-70213214 GAGCATGAGCTGAAGCAGGGCGG - Intergenic
975305828 4:72847809-72847831 GAGTGTGAGCTGAAGCAGGGAGG + Intergenic
975524168 4:75331146-75331168 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
975638700 4:76477821-76477843 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
975717246 4:77216871-77216893 AAGTTTGGTCAGAAGCAAGGTGG + Intronic
975854587 4:78610164-78610186 TAGTATGAGAAGAAGTAAGGTGG - Exonic
976142251 4:82004335-82004357 GAGTATCAGAAGAAGCAAGAAGG - Intronic
976978009 4:91187124-91187146 GAGTGTGAGCCAAAGCAAGGTGG - Intronic
977288696 4:95139901-95139923 CAGTGTGAGCCGAAGCAGGGTGG - Intronic
977440934 4:97066595-97066617 CAGTATGTGCAAAAGCCATGTGG + Intergenic
978089545 4:104697935-104697957 GAGTATAAGGAGAAGAAAGGGGG + Intergenic
978110780 4:104961745-104961767 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
978660240 4:111118010-111118032 CAGGAAGAGTAGGAGCAAGGAGG + Intergenic
978906712 4:114013466-114013488 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
979023045 4:115526975-115526997 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
980151736 4:129056080-129056102 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
980303822 4:131030156-131030178 CAGCAGGGGCAGTAGCAAGGTGG + Intergenic
981501564 4:145457684-145457706 AAGTGTGAGCGGAAGCAGGGCGG + Intergenic
982304136 4:153911778-153911800 CTGTATGGGCTGAAGAAAGGAGG - Intergenic
982463354 4:155699170-155699192 CAGTCTGAAAAGAAGCAAAGAGG - Intronic
982815468 4:159878220-159878242 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
982848079 4:160276409-160276431 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
982915498 4:161203793-161203815 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
982998824 4:162386573-162386595 CAGTATCTGGAGGAGCAAGGAGG - Intergenic
983249259 4:165326555-165326577 CAGTTTGAGCAAAAGCATGGAGG + Intergenic
983285006 4:165728151-165728173 AAGTATGAGCAGAAGAAAGTTGG + Intergenic
983362352 4:166743630-166743652 GAGTATGAGCCGAAGCAGGGCGG + Intronic
983564027 4:169130954-169130976 CAGTGTGAATAGAAGCAATGTGG + Intronic
983840777 4:172455059-172455081 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
984443711 4:179806218-179806240 CAGTATAAGCAGAACTAAGAGGG + Intergenic
985028041 4:185758748-185758770 CAGTATGAGGCACAGCAAGGAGG - Intronic
985317328 4:188672336-188672358 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
985473830 5:66099-66121 GAGTGTGAGCCGAAGCAGGGTGG - Intergenic
986025975 5:3851604-3851626 CACTATGGAAAGAAGCAAGGAGG - Intergenic
986280094 5:6315700-6315722 CAGCAGGAGCAGGAGGAAGGTGG - Intergenic
988204007 5:28110806-28110828 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
988404857 5:30811102-30811124 CAGTATGTGCATAAGCAACCAGG + Intergenic
988618130 5:32794853-32794875 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
988658979 5:33243582-33243604 CAGTATGTGGAGAAGAAAGAAGG - Intergenic
988970712 5:36465105-36465127 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
989225364 5:39021591-39021613 GAGCATGAGCACAAGCAAGGTGG - Intronic
989345331 5:40423184-40423206 GAGGATGAGCCGAAGCAGGGCGG - Intergenic
989358114 5:40567359-40567381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
990244922 5:53854670-53854692 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
991124098 5:63050225-63050247 CAGTGAGAGCATAAGGAAGGAGG - Intergenic
991436484 5:66601563-66601585 CAGGATGAGCAGGAGTTAGGTGG + Intronic
991651986 5:68865112-68865134 CAGAGTGGGCAGAAGCAGGGTGG + Intergenic
992077767 5:73206913-73206935 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992287207 5:75247990-75248012 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992740702 5:79770583-79770605 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
992908618 5:81373211-81373233 GAGGGTGAGCCGAAGCAAGGTGG + Intronic
993069057 5:83135189-83135211 GAGCATGAGCCGAAGCAGGGTGG - Intronic
993541543 5:89159022-89159044 GAGGTCGAGCAGAAGCAAGGTGG + Intergenic
993546568 5:89220051-89220073 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
993757712 5:91751497-91751519 GAGGATGAGCCGAAGCAGGGTGG - Intergenic
993888243 5:93442217-93442239 GAGTGTGAGCTGAAGCAGGGCGG + Intergenic
994014963 5:94955109-94955131 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
994377991 5:99037453-99037475 GAGGGTGAGCTGAAGCAAGGTGG + Intergenic
995790742 5:115883499-115883521 AAGGGTGAGCAGAAGCAGGGTGG - Intronic
996426701 5:123320609-123320631 GAGGATGAGCAGAAGAAGGGTGG - Intergenic
996428000 5:123335642-123335664 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
996477831 5:123941541-123941563 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
997606950 5:135182037-135182059 CAGTATGAGCTGAGACAAGAAGG + Intronic
997809608 5:136954339-136954361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
999630662 5:153567738-153567760 AAATAAGTGCAGAAGCAAGGTGG + Intronic
999694601 5:154178008-154178030 CAGCATGAGCAAAGGCATGGGGG + Intronic
1000412362 5:160947051-160947073 GAGCATGAGCCGAAGCAGGGTGG - Intergenic
1000525854 5:162356613-162356635 CAGTATGAGAAACAGCATGGAGG - Intergenic
1000575979 5:162975788-162975810 CCTTATAAGCAGAAGCAAGGTGG - Intergenic
1001422770 5:171599948-171599970 CAGTTTCTGCAGCAGCAAGGGGG + Intergenic
1002173092 5:177386118-177386140 GAGGAGGAGCAGAAGCCAGGTGG + Exonic
1002736737 5:181395605-181395627 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1002747962 6:79217-79239 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1003044103 6:2717071-2717093 CAGTATGAGCAGAAACAGGTTGG + Intronic
1003452926 6:6253378-6253400 CAATGTTAGCAGAAGCAAGTAGG + Intronic
1004702334 6:18091049-18091071 CAGTGTGAGCAATGGCAAGGAGG - Intergenic
1004715577 6:18213630-18213652 CAAAGTGAGCAGAAGAAAGGTGG - Intronic
1004793983 6:19060686-19060708 AACCATGAGCAGAAGGAAGGAGG - Intergenic
1004848208 6:19669225-19669247 GAGTATTAGCAGAAGAAAGTTGG - Intergenic
1004863326 6:19829046-19829068 CAGCATGTGCAGAAGCTTGGAGG - Intergenic
1004938665 6:20532804-20532826 CAGCCAGAGCAAAAGCAAGGAGG - Intergenic
1006452186 6:34111695-34111717 CAGAATGGGCAGCAGCCAGGTGG + Intronic
1007249516 6:40486271-40486293 GAGGATGAGCAGAATCAAGTGGG + Intronic
1008193639 6:48491520-48491542 CAGTAGGAGTAGCAGAAAGGGGG - Intergenic
1008474647 6:51922912-51922934 GAGTGTGAGCCGAAGCAGGGTGG - Intronic
1008648347 6:53539232-53539254 CAGGATGAGGAGAGGTAAGGGGG - Intronic
1009570095 6:65374233-65374255 AAGGGTGAGCAGAAGCAGGGTGG + Intronic
1009964368 6:70563265-70563287 CAGTATAACCAGAAGTCAGGGGG - Intergenic
1009990992 6:70842753-70842775 CAGAATGAGGAGAAGCAAAGAGG - Intronic
1010147586 6:72689241-72689263 GAGTAAGAGCAGAGACAAGGGGG + Intronic
1010574870 6:77518357-77518379 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1010671699 6:78694469-78694491 GAGCATGAGCTGAAGCAGGGCGG + Intergenic
1011235656 6:85213452-85213474 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1011541202 6:88432125-88432147 CAGTAGGAGCAGAGGCAGAGAGG - Intergenic
1011831315 6:91374987-91375009 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1012083159 6:94785735-94785757 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1012668917 6:102015650-102015672 CAGTAGCAGCAGCAGCACGGTGG - Intronic
1012799010 6:103801997-103802019 GAGCATGAGCCGAAGCAGGGCGG + Intergenic
1012933194 6:105338564-105338586 GAGCATGAGCCGAAGCAGGGCGG + Intronic
1013682506 6:112541095-112541117 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1013813977 6:114075717-114075739 CAGTATCTGAAGAAGAAAGGAGG - Intronic
1013819713 6:114139782-114139804 CAGTATGACCAGAACCCAGGTGG - Intronic
1013920239 6:115394892-115394914 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1013939506 6:115644994-115645016 GAGTGCGAGCAGAAGCAGGGTGG + Intergenic
1014527905 6:122522706-122522728 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1016526775 6:145010537-145010559 CAGCATGAGCAGAATAAATGTGG + Intergenic
1016875911 6:148864468-148864490 GAGCATGAGCCGAAGCAGGGCGG - Intronic
1016899243 6:149084838-149084860 AAGTTTGAACAGAAGCAATGTGG + Intergenic
1017467621 6:154708987-154709009 CAGTCTGGGTAGAAGCAAAGAGG + Intergenic
1017570774 6:155742140-155742162 GAGTCTGAGGAGGAGCAAGGTGG - Intergenic
1018021184 6:159763167-159763189 AACTCTGAGCAAAAGCAAGGAGG - Intronic
1018113927 6:160564673-160564695 GAGAGTGAGCCGAAGCAAGGCGG + Intronic
1018175837 6:161178595-161178617 GAGTGTGAGCTGAAGCAGGGTGG - Intronic
1018641982 6:165912456-165912478 CAGAATGGGCTGAAGCAAGAAGG - Intronic
1019241836 6:170671134-170671156 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1019954769 7:4404911-4404933 CAGTAAGAACAGTACCAAGGAGG - Intergenic
1020052878 7:5094075-5094097 CAGTATGAGGAGCAGAAAGAGGG + Intergenic
1020823930 7:13003261-13003283 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1021347751 7:19548540-19548562 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1022058930 7:26770750-26770772 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1023048514 7:36231703-36231725 CAGAATCAGCAGAAGAAAGGCGG + Intronic
1023119988 7:36899448-36899470 CAGCATGAGCAAAGGCAAGGAGG + Intronic
1023511707 7:40959969-40959991 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1023894230 7:44418771-44418793 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1026489149 7:70847843-70847865 CAGTATGAACAGCAGAAAGAGGG + Intergenic
1028630086 7:92925197-92925219 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1028965980 7:96801661-96801683 CAGTATGAGCTGGGGGAAGGGGG + Intergenic
1030771178 7:113476204-113476226 TAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1030919031 7:115356861-115356883 CAGGAGAAGCAGAAGCAAGTTGG + Intergenic
1031031752 7:116743080-116743102 GAGGTTGAGCTGAAGCAAGGTGG + Intronic
1031071301 7:117165046-117165068 CAGTTTGAGCAGAAACACGGTGG + Intronic
1032659834 7:133970640-133970662 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1032774098 7:135091744-135091766 CAGTATGAGCAGAAGCAAGGAGG - Intronic
1032893225 7:136222315-136222337 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1034314402 7:150116928-150116950 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1034792493 7:153983841-153983863 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1034827269 7:154277083-154277105 TAGTATGAGCTAAAGCAAGAAGG + Intronic
1035329457 7:158086664-158086686 CAGTATGAGCTGAAACGAGAAGG + Intronic
1035506281 8:136962-136984 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1035793982 8:2336757-2336779 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1035798823 8:2384951-2384973 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1036708439 8:11061771-11061793 AAGAATGAGAAGAAGGAAGGGGG + Intronic
1037033268 8:14136322-14136344 AAGTGTGAGCCGAAGCAGGGTGG + Intronic
1037285559 8:17294725-17294747 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1037602232 8:20406770-20406792 CATTATGAGCAGAAACAAGGTGG - Intergenic
1037626059 8:20607932-20607954 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
1037739254 8:21592290-21592312 CAGCATGAGCAGAAGGACAGAGG + Intergenic
1039562035 8:38520293-38520315 CAGGATGGGAGGAAGCAAGGAGG + Intronic
1040431785 8:47349941-47349963 GAGTGTGAGCCGAAGCAGGGCGG - Intronic
1040451759 8:47554715-47554737 AAGTGTGAGCCGAAGCAGGGTGG - Intronic
1041193056 8:55372905-55372927 CTGTCAGAGCAGATGCAAGGGGG + Intronic
1041273508 8:56132837-56132859 CAGTATGAGAACCAGCAAGCTGG + Intergenic
1041419160 8:57647278-57647300 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1041997661 8:64083819-64083841 GAGTGTGAGCTGAAGCAGGGCGG + Intergenic
1042478731 8:69280045-69280067 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1043048818 8:75359823-75359845 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1043253749 8:78106872-78106894 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1043314538 8:78903874-78903896 CAGTATGAGCACAAGCTGAGAGG - Intergenic
1043528863 8:81127949-81127971 CAGTATGAGCAAATGTAAGAAGG + Intergenic
1043605180 8:81991078-81991100 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
1043818254 8:84830116-84830138 CAGTATGAACTGAAACAAAGAGG + Intronic
1044127328 8:88474432-88474454 CTGTACCAGCAGAAGCAAGGTGG + Intergenic
1044131011 8:88525032-88525054 GAGGATGAGCCAAAGCAAGGTGG + Intergenic
1044509559 8:93058759-93058781 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044611893 8:94099692-94099714 TAGGAAGAGCAGAATCAAGGGGG + Intergenic
1044694111 8:94905714-94905736 CACTATGAGCAGGACCAAGAAGG - Intronic
1044927046 8:97218335-97218357 CACTATCACGAGAAGCAAGGGGG + Intergenic
1044940346 8:97335434-97335456 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1045055709 8:98366724-98366746 CAGTCTCAGCTGAAGCCAGGTGG - Intergenic
1045088161 8:98710318-98710340 GAGCATGAGCTGAAGCAGGGCGG + Intronic
1045151873 8:99416713-99416735 GAGGGTGAGCCGAAGCAAGGTGG - Intronic
1045185265 8:99830895-99830917 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1045199581 8:99967069-99967091 GAGCATGAGCAGAAGCAGGGTGG + Intronic
1045390499 8:101710120-101710142 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1045438777 8:102189917-102189939 TGGTAGGAGCAGGAGCAAGGGGG + Intergenic
1046014550 8:108589901-108589923 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1046900745 8:119521145-119521167 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
1047247591 8:123158683-123158705 CAGTATGAGTACAAGCAGGTAGG + Intergenic
1047791854 8:128211364-128211386 CAGTCTGTGCAAAGGCAAGGAGG + Intergenic
1047995782 8:130334116-130334138 CAGAAGGAGCAGAAGCAAACTGG - Intronic
1048350431 8:133611553-133611575 CAATCTGAGTAGAAGAAAGGAGG + Intergenic
1049342519 8:142120807-142120829 CAGAAGGAGCACAAGTAAGGTGG - Intergenic
1049880198 8:145056819-145056841 CAGGGTGAGGAGAAGCAGGGGGG - Intergenic
1049905460 9:212735-212757 CAGTATGATCTGAGGCAAGATGG + Intergenic
1050648377 9:7747123-7747145 CAGTATGTTCAGAAGTAAGAGGG - Intergenic
1050775684 9:9257224-9257246 AACTCTGAGCAGAAGGAAGGAGG + Intronic
1050881011 9:10700704-10700726 CAGTGTGAGCAGCAGCACTGTGG - Intergenic
1050973990 9:11912724-11912746 CAGTGTGAGCAGAAGCAGGTGGG - Intergenic
1051452057 9:17207635-17207657 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1051978637 9:22985680-22985702 CAGTAGGAGCACAAGTAATGAGG + Intergenic
1052144127 9:25026158-25026180 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1052329287 9:27251328-27251350 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
1052813971 9:33085590-33085612 GAGTGTGAGCCAAAGCAAGGTGG + Intergenic
1054887304 9:70212592-70212614 GAGTGTGAGCTGAAGCAGGGTGG - Intronic
1054972307 9:71102555-71102577 GAGTATGTGCAGAAGCAGTGTGG - Intronic
1055013907 9:71595687-71595709 GAGTGTGAGCCGAAGCAGGGCGG + Intergenic
1055345124 9:75327443-75327465 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1055628676 9:78200799-78200821 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1056002564 9:82232420-82232442 CACTATAATGAGAAGCAAGGGGG + Intergenic
1056385227 9:86091052-86091074 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1057256947 9:93557523-93557545 CAGTATGAGCTGAAACAAGAAGG + Intronic
1057460233 9:95254424-95254446 GAGGGTGAGCAGAAGCCAGGTGG + Intronic
1058231760 9:102435056-102435078 CAGTTTGAGCAGAATTAATGTGG + Intergenic
1058265712 9:102897255-102897277 GAGGGTGAGCAGAAGCAGGGAGG + Intergenic
1059323347 9:113486327-113486349 AAGCATGAGCAAAGGCAAGGAGG + Intronic
1059877625 9:118653278-118653300 AACCATGAGCAGAAGCATGGAGG + Intergenic
1060348388 9:122836746-122836768 TGGTGAGAGCAGAAGCAAGGTGG + Intergenic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1060724296 9:125997019-125997041 CAGAAAGAGCAGTAGAAAGGAGG - Intergenic
1060733734 9:126053335-126053357 CAGCATGGGCAAAAGCAAGGAGG - Intergenic
1060882463 9:127127508-127127530 GACTATGATCAGAAGCAGGGAGG - Intronic
1060922777 9:127434132-127434154 CACCATGAGCAGAAGCATGGAGG - Intronic
1061552430 9:131345363-131345385 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1062170333 9:135131321-135131343 CAGTCTGAGAAGAAGCAATTTGG + Intergenic
1062190716 9:135246619-135246641 GAGGATGAGCAGAAGGAAGGAGG - Intergenic
1062372613 9:136247807-136247829 CAGAAGGAGCAGCAGCGAGGTGG + Intergenic
1203573148 Un_KI270744v1:151631-151653 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
1203602027 Un_KI270748v1:20368-20390 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1186643532 X:11482518-11482540 CAGTATGAGCACAAGGAAGGTGG - Intronic
1186773393 X:12839656-12839678 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1186774941 X:12855044-12855066 GAGGGTGAGCAGAAGCAAGGTGG - Intergenic
1187289564 X:17940068-17940090 CAGTGAGAGCAGAAGCAGGAGGG - Intergenic
1187620445 X:21047354-21047376 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1187660759 X:21544734-21544756 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1188193129 X:27196830-27196852 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1189163536 X:38835918-38835940 CAGTCTGAGCTGAAGAAATGTGG - Intergenic
1189712363 X:43826694-43826716 AAGTATGAGCAGAAGGAAAGGGG + Intronic
1189884908 X:45532777-45532799 CACTCTGAGCAGAAGCAGGAAGG - Intergenic
1190209519 X:48433610-48433632 GAGTATGACCCGAAGCAGGGCGG + Intergenic
1190502900 X:51096997-51097019 CAGTGTGAGCAGGAGCGTGGCGG - Intergenic
1190753482 X:53381445-53381467 CAGCATGTGCAGAGGCAAGGAGG - Intronic
1190963805 X:55278395-55278417 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1190979483 X:55443382-55443404 GAGGGAGAGCAGAAGCAAGGTGG + Intergenic
1191004996 X:55702268-55702290 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191024202 X:55896238-55896260 GAGGACGAGCAGAAGCAGGGTGG + Intergenic
1191135488 X:57059245-57059267 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1191148181 X:57190691-57190713 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1191174241 X:57482534-57482556 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191591253 X:62887957-62887979 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191676556 X:63797624-63797646 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191713133 X:64174156-64174178 CAGCATCAGCAGAAGCAAGTTGG - Intergenic
1191766804 X:64706345-64706367 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1191891583 X:65948541-65948563 CAGTATCAGAAGAAGAAAAGGGG - Intergenic
1191987306 X:66995435-66995457 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192740943 X:73892376-73892398 GAGTATGAGCCGAAGCAGGATGG + Intergenic
1192759273 X:74078346-74078368 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192949176 X:75998100-75998122 GAGCATGAGCTGAAGCAGGGTGG - Intergenic
1192998102 X:76533692-76533714 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1193019981 X:76781082-76781104 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193398182 X:81010527-81010549 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193514314 X:82445443-82445465 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1193571597 X:83151536-83151558 GAGGACGAGCAGAAGCAGGGTGG + Intergenic
1194203193 X:90979359-90979381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194284079 X:91988293-91988315 CAGTATGAGGAGGAGAAGGGAGG - Intronic
1194315371 X:92369793-92369815 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1194631539 X:96291548-96291570 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1194643487 X:96429882-96429904 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194957148 X:100194379-100194401 CAGTATGAACAGGTGCAAGAAGG - Intergenic
1194961132 X:100236775-100236797 GAGAATGAGCCGAAGCAGGGTGG - Intergenic
1194975377 X:100390858-100390880 CAAAATGAGCAGAGGCATGGTGG + Intronic
1195615069 X:106905674-106905696 GAGAATCAGCAGAAGGAAGGAGG + Intronic
1196133315 X:112181025-112181047 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1196367891 X:114943465-114943487 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1196914114 X:120514140-120514162 AAGGAGGAGCAGAAGCAACGGGG - Intergenic
1196944627 X:120811680-120811702 GAGTGTGAGCCGAAGCAGGGTGG + Intergenic
1197614400 X:128675351-128675373 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1197921325 X:131597443-131597465 CAGTATGAAAAAAAGCAAGTTGG + Intergenic
1197926853 X:131656071-131656093 TAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1198018233 X:132633137-132633159 CAGCATGAGCAGAGGCACAGAGG + Intronic
1198060648 X:133042490-133042512 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1198295482 X:135282783-135282805 GAGGGTGAGCAGAAGCAAGGTGG - Intronic
1198366138 X:135941703-135941725 GAGTGTGAGCCGAAGCAGGGCGG - Intergenic
1198592370 X:138198452-138198474 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
1198944624 X:141996603-141996625 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1199781208 X:151061690-151061712 CAGCAGGAGCAGAAACATGGTGG - Intergenic
1199979715 X:152914286-152914308 AAGTATGGGCAGAAGCCAGGGGG - Intergenic
1200549026 Y:4554785-4554807 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1200623420 Y:5481328-5481350 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1200664047 Y:5998794-5998816 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
1200858664 Y:7966473-7966495 ACCTGTGAGCAGAAGCAAGGGGG + Intergenic
1201563660 Y:15344161-15344183 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1201922123 Y:19245213-19245235 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1201971419 Y:19801769-19801791 GAGTATGAGATGAAGCATGGTGG + Intergenic
1202260542 Y:22965852-22965874 ACCTGTGAGCAGAAGCAAGGTGG - Intergenic
1202335109 Y:23800819-23800841 CAGCATGAGCTGAAGCAGGGTGG + Intergenic
1202413529 Y:24599593-24599615 ACCTGTGAGCAGAAGCAAGGTGG - Intergenic
1202457256 Y:25070493-25070515 ACCTGTGAGCAGAAGCAAGGTGG + Intergenic
1202535658 Y:25869240-25869262 CAGCATGAGCTGAAGCAGGGTGG - Intergenic