ID: 1032777262

View in Genome Browser
Species Human (GRCh38)
Location 7:135126776-135126798
Sequence CCAGCATCACTTATTGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19604
Summary {0: 2, 1: 26, 2: 375, 3: 2902, 4: 16299}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032777262_1032777268 14 Left 1032777262 7:135126776-135126798 CCCTGTTCAATAAGTGATGCTGG 0: 2
1: 26
2: 375
3: 2902
4: 16299
Right 1032777268 7:135126813-135126835 CATGTGCAGAAAACTGAAACTGG 0: 59
1: 2328
2: 3416
3: 15026
4: 6727

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032777262 Original CRISPR CCAGCATCACTTATTGAACA GGG (reversed) Intronic
Too many off-targets to display for this crispr