ID: 1032777262 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:135126776-135126798 |
| Sequence | CCAGCATCACTTATTGAACA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 19604 | |||
| Summary | {0: 2, 1: 26, 2: 375, 3: 2902, 4: 16299} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1032777262_1032777268 | 14 | Left | 1032777262 | 7:135126776-135126798 | CCCTGTTCAATAAGTGATGCTGG | 0: 2 1: 26 2: 375 3: 2902 4: 16299 |
||
| Right | 1032777268 | 7:135126813-135126835 | CATGTGCAGAAAACTGAAACTGG | 0: 59 1: 2328 2: 3416 3: 15026 4: 6727 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1032777262 | Original CRISPR | CCAGCATCACTTATTGAACA GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||