ID: 1032778093

View in Genome Browser
Species Human (GRCh38)
Location 7:135136508-135136530
Sequence CTTGCCCAAGATAATCACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 135}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032778093_1032778099 27 Left 1032778093 7:135136508-135136530 CCTTAGTGATTATCTTGGGCAAG 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1032778099 7:135136558-135136580 CCCTCTGCCAGGTAGGTGCTCGG 0: 1
1: 0
2: 0
3: 21
4: 230
1032778093_1032778101 28 Left 1032778093 7:135136508-135136530 CCTTAGTGATTATCTTGGGCAAG 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1032778101 7:135136559-135136581 CCTCTGCCAGGTAGGTGCTCGGG 0: 1
1: 0
2: 1
3: 18
4: 186
1032778093_1032778095 1 Left 1032778093 7:135136508-135136530 CCTTAGTGATTATCTTGGGCAAG 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1032778095 7:135136532-135136554 GCAGAAGTCTACTTGCTTTTGGG 0: 1
1: 0
2: 0
3: 12
4: 145
1032778093_1032778096 16 Left 1032778093 7:135136508-135136530 CCTTAGTGATTATCTTGGGCAAG 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1032778096 7:135136547-135136569 CTTTTGGGATGCCCTCTGCCAGG No data
1032778093_1032778097 20 Left 1032778093 7:135136508-135136530 CCTTAGTGATTATCTTGGGCAAG 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1032778097 7:135136551-135136573 TGGGATGCCCTCTGCCAGGTAGG No data
1032778093_1032778094 0 Left 1032778093 7:135136508-135136530 CCTTAGTGATTATCTTGGGCAAG 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1032778094 7:135136531-135136553 AGCAGAAGTCTACTTGCTTTTGG 0: 1
1: 0
2: 0
3: 16
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032778093 Original CRISPR CTTGCCCAAGATAATCACTA AGG (reversed) Intronic
901196763 1:7444605-7444627 CTTGCCCAACATCATCAGCAGGG - Intronic
903489802 1:23719678-23719700 GTAGCCCAAAATAATCACAAGGG - Intergenic
903894255 1:26593082-26593104 CTTGCCCAAGGAAATGAATAAGG + Intergenic
903894530 1:26595238-26595260 CTTGCCCAAGGAAATGAATAAGG - Intergenic
906418087 1:45638399-45638421 GTCTCCTAAGATAATCACTAAGG + Intronic
918033507 1:180841598-180841620 CCTGGCCAAGACAATCATTAAGG - Intronic
918996140 1:191762669-191762691 GTTGCAGAAGATAAACACTATGG - Intergenic
921530348 1:216274885-216274907 CTTCCCCACGATAATCTCTAAGG + Intronic
922203065 1:223422993-223423015 CTTGCCCAAGTTCCTCTCTAAGG - Intergenic
924400014 1:243669352-243669374 CGTGCCCAAGAGAAATACTATGG + Intronic
1067174292 10:43931634-43931656 TTTCCCCTGGATAATCACTAGGG + Intergenic
1067751020 10:48971107-48971129 CTTGCTCTAGAATATCACTAGGG + Intronic
1068936753 10:62643212-62643234 CAGGCCCAATATAATCACAAGGG + Intronic
1070113889 10:73510386-73510408 ACTGTGCAAGATAATCACTATGG + Intronic
1073298602 10:102456741-102456763 CTAGCCCAAGTCAATCACTATGG - Intergenic
1073831130 10:107384762-107384784 CTCAGCCAAGAAAATCACTAGGG + Intergenic
1076017109 10:127036675-127036697 CTGGCCCAAGATATTCTTTAAGG - Intronic
1079981230 11:27153557-27153579 CAGGCCCAATATAATCACAAAGG + Intergenic
1080104166 11:28494484-28494506 CTTGCTCAAGATACACAGTAAGG - Intergenic
1081690064 11:45071814-45071836 CTTGCCCAAGATTATCACACGGG - Intergenic
1082913162 11:58400265-58400287 CTTGTCAAAGATAATCTCCAGGG + Intergenic
1084026536 11:66453827-66453849 CTTGCCCAAGGTCACAACTAGGG + Intronic
1085169582 11:74437616-74437638 CTGGCCTAAGATAATGAGTATGG + Intergenic
1086889142 11:92236223-92236245 CTTGCCCACAATGGTCACTATGG - Intergenic
1088755604 11:112882846-112882868 CATGCCCAAGATATTTAGTATGG + Intergenic
1089423784 11:118352649-118352671 CTAGGCCAAGACAATCAGTATGG - Intronic
1091179625 11:133592010-133592032 CCTGCACAAGATTCTCACTATGG + Intergenic
1095480985 12:42635341-42635363 CTTGTCAAAGATAGTAACTATGG - Intergenic
1095672749 12:44879013-44879035 TATGCCCAATATAATCACGAGGG + Intronic
1096502364 12:52072225-52072247 CTTGCCCAAGATCATGAGCATGG + Intronic
1100675935 12:96867824-96867846 ATTGCACAAAATAATGACTATGG + Intronic
1101538308 12:105641061-105641083 CTTGCTCCAGATCATCCCTAAGG - Intergenic
1101764731 12:107687101-107687123 CTTGACCAAGATAATGATGATGG + Intronic
1101847287 12:108372687-108372709 CATGCCCAAGATGATCTCTGAGG + Intergenic
1102422441 12:112814671-112814693 CTTGCCCAAGATCACCAGGAAGG - Intronic
1103437024 12:120934704-120934726 CTAGCCCAATATAATCACACAGG + Intergenic
1107417548 13:40215402-40215424 CTTAACCAAGATAGTCTCTATGG + Intergenic
1107921321 13:45211331-45211353 ATTACCCAACATTATCACTAAGG + Intronic
1108087015 13:46804069-46804091 ATTGCCCAAGCAAATCACTAAGG + Intergenic
1108592318 13:51922898-51922920 GTGGCCCCAGATAATCACAAGGG - Intergenic
1108743227 13:53360770-53360792 TTTCCCCAAGATGATAACTATGG - Intergenic
1109903776 13:68810395-68810417 CTTGCCAATTATAATCACTTTGG + Intergenic
1111663799 13:91242970-91242992 CTTTCTCAAGAAAATTACTATGG + Intergenic
1112470152 13:99681003-99681025 CTGGTCCAAAATAATCACAAAGG - Intronic
1115161023 14:30394268-30394290 CTTGACCAATATAATCCCTAAGG - Intergenic
1115278025 14:31630257-31630279 CTTGCCCAAAATAAACACAAAGG - Intronic
1118717639 14:68571586-68571608 CTGGCCCAACGTAATCACAAGGG - Intronic
1125780995 15:42267891-42267913 CTGGAACCAGATAATCACTAAGG + Intronic
1126250675 15:46564925-46564947 CTTGTCCAAGACAATCAAGATGG - Intergenic
1126562883 15:50063334-50063356 GTTGCCCATTAGAATCACTAGGG + Intronic
1127949601 15:63792208-63792230 CTTGCCCAAGATCATTTCTTGGG - Intronic
1131290463 15:91102316-91102338 CTTGCCCAAGACACTCACCTAGG - Intronic
1136146023 16:28317253-28317275 CAGGCCCAAGATAACCACAAGGG - Intronic
1140798081 16:78459166-78459188 CTTGGCCTAGATAATCTCTAAGG - Intronic
1144548138 17:16215993-16216015 CCTGCCCAAGATACTTTCTAGGG + Intronic
1144574966 17:16423595-16423617 GTTGTCCGAGATCATCACTAGGG - Exonic
1147033681 17:37663421-37663443 CTTGCCATATATAATCTCTATGG + Intergenic
1147036555 17:37685917-37685939 CTTGCCCAAGATTCTCTCTCTGG - Intergenic
1150471627 17:65442460-65442482 CTTCCCCAGGACAATCACTGTGG - Intergenic
1157186341 18:45543287-45543309 CTTACCCAAGATAATATCTGTGG + Intronic
1158509100 18:58074614-58074636 ATTACCCAAGATCATCTCTATGG - Intronic
926614473 2:14981982-14982004 TTTGTTCAAGAAAATCACTACGG - Intergenic
930911016 2:56629876-56629898 CTTGACCAATATAATAACTTAGG - Intergenic
933276561 2:80290394-80290416 CTTACCCACGGTAATCACTGGGG - Intronic
933637912 2:84727048-84727070 CTTCCCCAAGATAATTTTTAGGG - Intronic
933898707 2:86834029-86834051 CAACCCCAAGATAATCAATAGGG - Intronic
934126850 2:88902502-88902524 CTTTCCCAAGAGAATCAATGGGG - Intergenic
936122383 2:109757885-109757907 CCTGCCAATGATAATTACTAAGG - Intergenic
936222310 2:110613589-110613611 CCTGCCAATGATAATTACTAAGG + Intergenic
938769373 2:134487765-134487787 CTTGCCCAAGATGATTTCAAAGG - Intronic
943488649 2:188520918-188520940 CTTGAAAAAAATAATCACTAAGG - Intronic
945932315 2:215867151-215867173 GTGGCCCAATATAATCACAAGGG - Intergenic
946915978 2:224522135-224522157 CTTACCAAATTTAATCACTAAGG + Intronic
1169524902 20:6413652-6413674 TTGGCCCAATATAATCACGAGGG + Intergenic
1169804227 20:9542733-9542755 CTTGCCTGAGATAACCAGTAGGG - Intronic
1172789446 20:37492582-37492604 ATTGGCCAAGAAAGTCACTAAGG + Intronic
1173063709 20:39687854-39687876 CTTCCCTAAGATCAACACTAAGG + Intergenic
1180245957 21:46547478-46547500 TTTGCTCAAGAGAATCTCTAAGG - Intronic
1181896144 22:26109568-26109590 CTTGAACAAGATAATTGCTATGG - Intergenic
1182956319 22:34429953-34429975 CTTACACAAGTTAATCAATAAGG - Intergenic
1183371986 22:37437996-37438018 CTTGCCCAAGATCACCAGTCAGG - Intergenic
951130038 3:19030859-19030881 CTTCCCCAATATAGTCACTCTGG - Intergenic
952519525 3:34142729-34142751 CTTGTCCAAAATAATCCCTCTGG + Intergenic
955156875 3:56425626-56425648 CTTGCCCAAATTAATTAGTAAGG + Intronic
955588255 3:60505726-60505748 CTTGGCCAAGATAATCAGCAGGG - Intronic
956774449 3:72553289-72553311 GTTGCACAACAGAATCACTAGGG + Intergenic
957490205 3:80916109-80916131 CTTGATTAAGATAATCTCTAAGG + Intergenic
961359557 3:126358237-126358259 CTTGCCCAAGAAAAACACGTGGG + Intergenic
964054576 3:152437515-152437537 GTTGCACCAGATAATCTCTAAGG + Intronic
964193049 3:154028405-154028427 CCTGCACAAGATGATCTCTAAGG - Intergenic
964443883 3:156740164-156740186 CCTGCCCAAGACAATAAGTATGG - Intergenic
968819881 4:2842922-2842944 CTTCCCATAGTTAATCACTAGGG - Intergenic
971150635 4:24027879-24027901 AGTGCCCATAATAATCACTAAGG + Intergenic
971596164 4:28531712-28531734 TGTGCCCAATATAATCACAAAGG + Intergenic
971616564 4:28797986-28798008 CTTCCCTAAGATAATCAATTAGG + Intergenic
974212860 4:58804356-58804378 CTAGCACAAGATAATCTCTTTGG + Intergenic
977530794 4:98198557-98198579 CATCCCCAAGACAATCACTATGG + Intergenic
978744485 4:112176217-112176239 CATGAGAAAGATAATCACTAAGG + Intronic
979320807 4:119323168-119323190 CTTGCCCAAGATATTACTTAGGG + Intergenic
980715567 4:136624332-136624354 CCTGCTCAAGATCATCACAAAGG + Intergenic
981517900 4:145630291-145630313 CTTGCTCATAATAAGCACTAAGG + Intronic
983241423 4:165237491-165237513 CTTGTCAAAGATAATCTCCAGGG + Intronic
988088608 5:26504898-26504920 CTCGCCCAAGAGACTAACTAGGG - Intergenic
989818284 5:45763253-45763275 ATTGCAAAAGATAATCACTAAGG - Intergenic
990487438 5:56273142-56273164 TTTGCCTAAAATAATTACTATGG - Intergenic
994724383 5:103416971-103416993 CTGGCCCAATATCATCACAAGGG - Intergenic
995909379 5:117167573-117167595 CTTGCCCATCATAAGCATTAAGG + Intergenic
996349938 5:122528072-122528094 CTTGACCAAGCAAATGACTATGG - Intergenic
998491524 5:142551315-142551337 CTTGCCACAGACAATCACTAGGG - Intergenic
998872299 5:146564698-146564720 CTTGCCCAAGATAAGAGCTGGGG - Intergenic
1003697849 6:8429770-8429792 TTTGCCCAAGATAGTCACTTAGG - Intronic
1005684536 6:28240313-28240335 CTCTCCCATGATTATCACTATGG - Intergenic
1006228230 6:32558609-32558631 CTGGCACAAGGTTATCACTAAGG - Intronic
1006230843 6:32584790-32584812 CTGGCACAAGGTCATCACTAAGG - Intronic
1006312150 6:33268434-33268456 CCTTCCCAAGATCTTCACTATGG - Intronic
1010371984 6:75121089-75121111 CTAGCCAAAGATAAAAACTAAGG + Intronic
1013609712 6:111782977-111782999 CCTTCCCAAGATAGTCACTGTGG - Intronic
1013920745 6:115400322-115400344 GTTGACCAAGAAAATCAGTAGGG - Intergenic
1013942058 6:115676422-115676444 ATTACCCTAGATAATCACTGAGG - Intergenic
1016100830 6:140098027-140098049 CTTCCCCAACATACTCTCTATGG + Intergenic
1017052871 6:150409486-150409508 CTTGCCCAAGATCACCATTTAGG - Intergenic
1017355616 6:153503804-153503826 CTTGGCCAAGATAAGGACAATGG + Intergenic
1020515126 7:9107743-9107765 CTTGTCCAAGATAATCAAGGTGG + Intergenic
1023067731 7:36395455-36395477 CAGGCCCAACATAATCACAAAGG - Intronic
1030794001 7:113764767-113764789 CTTGTCCAACAGAATCACCAGGG + Intergenic
1031577376 7:123431308-123431330 TTTGGCCCAGATAATCTCTATGG - Intergenic
1031759845 7:125698932-125698954 GTTGCCCAATGTAATCACAAGGG - Intergenic
1032778093 7:135136508-135136530 CTTGCCCAAGATAATCACTAAGG - Intronic
1033671728 7:143499696-143499718 TTTGCCCAATATAATCACAAGGG + Intergenic
1036702546 8:11022691-11022713 CTTGCGCAAGATAACCTCTCTGG - Intronic
1038709718 8:29932116-29932138 CTTACCCAATATGATCACTGTGG - Intergenic
1043632382 8:82352320-82352342 CTTTCCAAAGATACTCAATATGG + Intergenic
1043760192 8:84058906-84058928 CCTGGCCAAAATAACCACTATGG - Intergenic
1044475547 8:92621138-92621160 GTGGCCCAATATAATCACAAAGG + Intergenic
1045259839 8:100562708-100562730 TGTGCCCAATATAATCACAAGGG - Intergenic
1047239716 8:123074795-123074817 CTTGGGGAAGTTAATCACTAAGG + Intronic
1047351839 8:124081438-124081460 CTTGCCCAAGATCATCAATCAGG - Intronic
1047365832 8:124210606-124210628 CTTGCCCAAGATAAAAACGCTGG + Intergenic
1050565518 9:6878053-6878075 TTTGAGCAAGATAATGACTAAGG + Intronic
1051337309 9:16077456-16077478 CTTGGCCAAGCGAATCACTTCGG + Intergenic
1052235209 9:26204937-26204959 CTTGCTAAAGATAAGGACTATGG - Intergenic
1055231877 9:74076194-74076216 ATTTCCCAATATAATCACTCTGG + Intergenic
1055395371 9:75868540-75868562 CTAACCTAAGATAATCACAAGGG - Intergenic
1059486281 9:114629472-114629494 CTGGCCCAATGTAATCACAAGGG - Intronic
1186823579 X:13315436-13315458 CTTGCTCAGTATAATCACTGTGG - Intergenic
1193964117 X:87962642-87962664 ATTGCAGAAGATAATCACCAAGG + Intergenic
1194437988 X:93893548-93893570 CTTGCCCAAGACCATCAAGATGG - Intergenic
1196228300 X:113190806-113190828 ATTACACAAGATAATCATTATGG - Intergenic
1197281643 X:124543769-124543791 TTTGCCCAAGATCTTCACCATGG + Intronic
1199504413 X:148545193-148545215 CTTGCCCAAGATCATGCCTTTGG + Intronic