ID: 1032778097

View in Genome Browser
Species Human (GRCh38)
Location 7:135136551-135136573
Sequence TGGGATGCCCTCTGCCAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032778093_1032778097 20 Left 1032778093 7:135136508-135136530 CCTTAGTGATTATCTTGGGCAAG 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1032778097 7:135136551-135136573 TGGGATGCCCTCTGCCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032778097 Original CRISPR TGGGATGCCCTCTGCCAGGT AGG Intronic
No off target data available for this crispr