ID: 1032779365

View in Genome Browser
Species Human (GRCh38)
Location 7:135151299-135151321
Sequence TGGACTCATGTTTCTACCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032779361_1032779365 2 Left 1032779361 7:135151274-135151296 CCCTGTTTTGAAAAGAATTAGAA 0: 1
1: 3
2: 14
3: 108
4: 788
Right 1032779365 7:135151299-135151321 TGGACTCATGTTTCTACCAAAGG 0: 1
1: 0
2: 0
3: 15
4: 120
1032779362_1032779365 1 Left 1032779362 7:135151275-135151297 CCTGTTTTGAAAAGAATTAGAAC 0: 1
1: 0
2: 1
3: 29
4: 381
Right 1032779365 7:135151299-135151321 TGGACTCATGTTTCTACCAAAGG 0: 1
1: 0
2: 0
3: 15
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032779365 Original CRISPR TGGACTCATGTTTCTACCAA AGG Intronic
908346188 1:63236092-63236114 TGCAGACATGTTTCTTCCAATGG + Intergenic
910491667 1:87779324-87779346 TGGACTTATTTCTCTATCAAAGG - Intergenic
917619546 1:176782084-176782106 AGCATTCAGGTTTCTACCAATGG - Intronic
917678269 1:177340676-177340698 TGAGCTCATGTTTCTGGCAATGG - Intergenic
917832537 1:178908232-178908254 TGCATTCATGTTGCTGCCAAGGG + Intronic
919632127 1:199969753-199969775 TAGGCTCATGTTTATACCACAGG - Intergenic
920462340 1:206150806-206150828 TGGAGGCATGGTTTTACCAATGG + Intergenic
922532373 1:226354149-226354171 TGAACTCATGTTTCTGCCCAGGG - Intergenic
923014026 1:230112200-230112222 AGGACTCATGTGTCTACCTGTGG + Intronic
923789451 1:237099566-237099588 TGGATTCATCTTGCAACCAATGG - Intronic
924792011 1:247260164-247260186 TGAACTTACATTTCTACCAATGG - Intergenic
1066471561 10:35702676-35702698 TTTATTCATGTTTCTACAAAGGG + Intergenic
1070021317 10:72588840-72588862 TGGACTGATTTTTCCCCCAAGGG - Intronic
1071208022 10:83306315-83306337 TTAACTCATGTGTCTTCCAATGG + Intergenic
1078489216 11:11753884-11753906 TGGCTTGGTGTTTCTACCAATGG - Intergenic
1080152125 11:29064548-29064570 TTGGCTCATCTTTCTACCCATGG - Intergenic
1081254447 11:40874972-40874994 TTGAGTCATATTTCTACAAAAGG + Intronic
1082660894 11:55910009-55910031 TGGCTTCATGTTTATACAAAAGG - Intergenic
1082884025 11:58065581-58065603 TGGGCTCATGTTGCTGACAAGGG + Intronic
1083109021 11:60386917-60386939 TCTACTCTTGGTTCTACCAATGG - Intronic
1095661086 12:44737580-44737602 TGGACTTATGTATTTACCATGGG - Intronic
1095731116 12:45508028-45508050 TGGATTAATGTTTCTAACATGGG - Intergenic
1095837987 12:46659313-46659335 TGGAGTGGTGTTTTTACCAACGG + Intergenic
1097710780 12:62914762-62914784 TGGACTCATCTACCTACAAAGGG + Intronic
1099473550 12:83079957-83079979 TGGAATTATTTTGCTACCAAAGG + Intronic
1101218558 12:102611104-102611126 TGGACTCAATTCTCTATCAAAGG - Intergenic
1105339710 13:19509898-19509920 TGGTTTCATTTTTCTCCCAATGG - Intronic
1110058989 13:71016981-71017003 TGGAATCTTGTTTCAACCCATGG + Intergenic
1112605241 13:100897960-100897982 TGGAGTCTTGTTTCTACATAGGG + Intergenic
1113445042 13:110359430-110359452 TGGACTCATGTATCTACCCTAGG + Intronic
1116227849 14:42174928-42174950 TGTACTCATGTTGCTTCAAAAGG + Intergenic
1119464402 14:74843628-74843650 TGTACTTATGTCTCTACCAAAGG - Intronic
1127576856 15:60300052-60300074 TGGCCTCATGTCTGTACCAAGGG + Intergenic
1128018424 15:64368555-64368577 TGGCCTTATTTTTCTCCCAAAGG - Intronic
1146318873 17:31830933-31830955 TGGACTTCTGTTTCTGGCAATGG + Intergenic
1150896259 17:69213907-69213929 TGGGCTGATGTTTCGACAAAAGG + Intronic
1156120477 18:33836680-33836702 GGGCTTCATGTCTCTACCAAGGG - Intergenic
1164084952 19:21892590-21892612 TGGACTCATGTTTGAACCTGTGG - Intergenic
930914404 2:56669707-56669729 TGCATCCATGTTTCTGCCAAGGG + Intergenic
936687358 2:114843292-114843314 ATTACTCATGTTTCTACCAGTGG + Intronic
939072618 2:137561238-137561260 TGGTCAAATGTTTATACCAAAGG + Intronic
939104982 2:137938358-137938380 TGCACTCATATCTCAACCAACGG - Intergenic
941423701 2:165317259-165317281 TTGATTAATGTTTCTACTAATGG - Intronic
942687935 2:178553642-178553664 TGGACTACTGTCTCTACCAAAGG - Exonic
944184556 2:196932592-196932614 TGGATTAATGTTACTATCAAAGG + Intergenic
945205810 2:207330987-207331009 TGGACTCATATCTCTCACAAAGG + Intergenic
946584980 2:221175859-221175881 TGGACAAATGTTTCAACCAAAGG + Intergenic
947184408 2:227442182-227442204 GGGACTCATATTTTCACCAATGG - Intergenic
1171987656 20:31671582-31671604 TGGACTTCTGTTTATACCAGGGG + Intronic
1173282935 20:41645484-41645506 TGGGCTCATATTTCTTTCAAAGG + Intergenic
1174712456 20:52721308-52721330 GGGATTCCTGTTTCTATCAAAGG + Intergenic
1175038971 20:56027623-56027645 TGGCCTCATGTGTGTACCAATGG + Intergenic
1175867665 20:62189479-62189501 AAGACTCCTGTCTCTACCAAAGG - Intronic
1182366613 22:29783427-29783449 TGGACTCCTGTTGCTAGAAAAGG + Intergenic
1184973814 22:48046807-48046829 TGGACTGATGTTTTTAATAATGG - Intergenic
952090319 3:29877509-29877531 TGGGCTAATGGTTCTACAAAAGG - Intronic
953330039 3:42045151-42045173 TGGACTCATGCTTCTGTTAAAGG + Intronic
954358457 3:50103032-50103054 TGGACACATGTTCCTCACAATGG + Intronic
958896924 3:99839593-99839615 TAGACTCTTATTTCTCCCAAGGG + Intronic
960528706 3:118739449-118739471 GGGACTCATTTTTCTAACAAAGG + Intergenic
961563895 3:127749896-127749918 GGGACACATGTTCCTAGCAAAGG + Intronic
961709028 3:128812765-128812787 TGGTCTCTTTTTTCTTCCAAAGG - Intronic
963366795 3:144345289-144345311 TGGGCTCCTGTTTCTAGAAAGGG + Intergenic
965249050 3:166318362-166318384 TGGAATCTTGATTCTATCAAAGG + Intergenic
966564851 3:181365376-181365398 TTTATTCATGTTTCTATCAAAGG - Intergenic
970056937 4:11984566-11984588 TCAACTAATGCTTCTACCAAGGG + Intergenic
971767061 4:30846282-30846304 TGGATTCATGTTGCTATCACAGG + Intronic
973655346 4:53042032-53042054 TGGTCTCATGGGTCTAACAAAGG + Intronic
975040143 4:69736191-69736213 GGAACTCATATTTCTACCACTGG - Intronic
975503803 4:75116717-75116739 GGAACTCAAGTTTCTACCACTGG - Intergenic
977816390 4:101417796-101417818 TGTACTCATGTATTTACAAATGG - Intronic
979271483 4:118767343-118767365 TGAACACATGGTTCTACCCACGG - Intronic
980461438 4:133119996-133120018 TTTACACATGTTTCTACCTATGG - Intergenic
981062023 4:140435339-140435361 TGGACGCACGTTTGTACTAAGGG + Intergenic
986046551 5:4043891-4043913 TGGACTCAAGTTCCCACCACTGG - Intergenic
988243807 5:28650956-28650978 TGGACTCAGGCATCTATCAAAGG - Intergenic
989147422 5:38262499-38262521 GGGAGTCATTTTTCTACAAAGGG - Intronic
989529972 5:42496720-42496742 TGGGATCATGTTTCAACTAAGGG - Intronic
990988825 5:61665445-61665467 TGGAATTATGTTTCTACCTGAGG - Intronic
991899977 5:71451029-71451051 TCTACACGTGTTTCTACCAATGG - Intergenic
994157593 5:96521274-96521296 TGGACTCATGCTTTTACTAGTGG - Intergenic
995891435 5:116956725-116956747 TGTACTCTTCTTTCTAGCAATGG - Intergenic
996808547 5:127486720-127486742 TGGTCTCTTGTTTCTAACAATGG - Intergenic
997753390 5:136371681-136371703 AGGACACATCTTTTTACCAAAGG + Intronic
1000197729 5:158975919-158975941 TGGACTCAGCTTTACACCAAAGG + Intronic
1001221019 5:169901073-169901095 AGGACTCATGATTCTCCCACCGG - Intronic
1003637804 6:7849508-7849530 TGTACTCATGATGCTACCATAGG - Intronic
1005197662 6:23308322-23308344 TGTGCTCATTTTTCTGCCAATGG - Intergenic
1006326695 6:33359656-33359678 TAGAATCAAGTTTCTACCAAAGG + Intergenic
1009530652 6:64809663-64809685 TCCACTCATGTTTCTGCAAAGGG - Intronic
1009812350 6:68684614-68684636 TGCACTCATTTTTCTCCCAATGG - Intronic
1011659664 6:89583481-89583503 GTGACTCATGTTTCTAGCAAAGG + Intronic
1013664026 6:112328394-112328416 TGGATTCATGTTTTAAGCAAAGG + Intergenic
1013746482 6:113352468-113352490 TGGTGGCATCTTTCTACCAAAGG + Intergenic
1013988867 6:116229755-116229777 TTGGCTCATGATTCTCCCAATGG - Intronic
1015186440 6:130421834-130421856 TTGACTCATGTTGCCACAAATGG + Intronic
1018206752 6:161443739-161443761 AGCACACTTGTTTCTACCAAAGG - Intronic
1021214716 7:17901468-17901490 TGGACTCAGGTTCCAACCACTGG + Intronic
1021315271 7:19141642-19141664 TCTACTCATATTTCTATCAATGG + Intergenic
1021395733 7:20145683-20145705 TGTATTTATGTTTCTGCCAAAGG - Intronic
1023998544 7:45176770-45176792 GGGACTCATGTTCCCAGCAATGG - Intronic
1024165029 7:46722512-46722534 AGGACTCATGCTTCTCCCATGGG + Intronic
1024503553 7:50140769-50140791 TTGACTAGTGTTTCTACCAGTGG + Intronic
1026430395 7:70341169-70341191 GAGACTCATGTCTCTGCCAAGGG - Intronic
1027167421 7:75845215-75845237 TGGACTCCTCTTTCAGCCAAGGG - Intronic
1028317510 7:89421753-89421775 TGGGGTCATGTTTCTAACTAGGG + Intergenic
1028832257 7:95340907-95340929 TGGCTTCATCCTTCTACCAATGG + Intergenic
1029269984 7:99371504-99371526 TGGACTCAGTTTTCTACCACTGG + Intronic
1030385645 7:108864651-108864673 TGGTCTCATGTTACTCCCCAGGG + Intergenic
1032779365 7:135151299-135151321 TGGACTCATGTTTCTACCAAAGG + Intronic
1035685959 8:1523555-1523577 AGGACTCAATTTTCTACCCAGGG - Intronic
1037933240 8:22896679-22896701 TGTAATGCTGTTTCTACCAAGGG - Intronic
1038754476 8:30327838-30327860 TGGACTAATGTTGTTATCAAGGG - Intergenic
1039205983 8:35155274-35155296 TGAATTCATTTTTCTAACAAAGG + Intergenic
1043956905 8:86371255-86371277 TGTAACCATTTTTCTACCAATGG + Intronic
1044753205 8:95436041-95436063 TTGGCCCATGTTTCTACCCAGGG - Intergenic
1048452405 8:134545102-134545124 TGGACTCATGTTTCACACAATGG + Intronic
1048747776 8:137634287-137634309 TGTAGTCTTGTTTCTACCTATGG - Intergenic
1050429266 9:5545278-5545300 TGAACTCATGTTTTTAACTACGG + Intronic
1051839504 9:21379259-21379281 TGGAATCCTGTTTCTCCCATGGG - Intergenic
1051851419 9:21513546-21513568 TGGACTTTTGTTTCTGGCAAAGG - Intergenic
1053266655 9:36720079-36720101 TGGCATGATGTTTCTACCACAGG + Intergenic
1055469245 9:76595057-76595079 GGGATTCATGATTATACCAAGGG + Intergenic
1055516422 9:77038146-77038168 TGTTCACTTGTTTCTACCAAAGG - Intergenic
1058345673 9:103958164-103958186 TGAATTAATGTTTCTACAAAGGG + Intergenic
1061884067 9:133582805-133582827 AGCACTCATGTCTCTACCCAAGG - Intronic
1186630888 X:11347812-11347834 TGGACTTATGTTTCTATTAATGG - Intronic
1187586813 X:20672007-20672029 TCGACTTAAGTTTCCACCAATGG - Intergenic
1189769608 X:44411265-44411287 TGAACTCATTTTTCAACAAAGGG - Intergenic
1194827028 X:98576886-98576908 TGGATTCATCTTTCCCCCAATGG - Intergenic
1195173912 X:102296573-102296595 AGCATTCATATTTCTACCAACGG - Intergenic
1195184953 X:102390520-102390542 AGCATTCATATTTCTACCAACGG + Intronic
1195244845 X:102986338-102986360 TGGACTCATGCTTGTCCCCATGG + Intergenic
1196074019 X:111555122-111555144 TGAACACATGTGTCTACAAAGGG - Intergenic
1196263841 X:113617875-113617897 TAGACTAATGTTTCTACTATTGG - Intergenic
1201492222 Y:14554789-14554811 AGGACACCTGTTTCTACCACTGG - Intronic