ID: 1032784536

View in Genome Browser
Species Human (GRCh38)
Location 7:135190109-135190131
Sequence CCCATAGTGAAAGCCGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 59}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032784536_1032784541 27 Left 1032784536 7:135190109-135190131 CCAAAGCCGGCTTTCACTATGGG 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1032784541 7:135190159-135190181 TTCCCATTCTGCTACCCATGAGG 0: 1
1: 0
2: 0
3: 18
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032784536 Original CRISPR CCCATAGTGAAAGCCGGCTT TGG (reversed) Intronic
904943455 1:34181438-34181460 CACAGAGTGAAAGTCGACTTGGG - Intronic
911179324 1:94847303-94847325 CTCATAGTGAAAGGCTGCTCAGG + Intronic
917840930 1:178976852-178976874 CTCATAGTGAAACTTGGCTTAGG + Intergenic
921604116 1:217136198-217136220 CCCAGAGAGAAACCCGGCTCCGG - Intronic
1063267781 10:4473591-4473613 CCCATAGTGGATGCGGGCATGGG + Intergenic
1065826969 10:29581270-29581292 CCCCTAGGGAAAGCCCACTTAGG + Intronic
1067064135 10:43094164-43094186 CCCATAGGGACAGCTGGCCTGGG + Intronic
1069722755 10:70560182-70560204 CCCAAAGTGCAAGCCTGCTCCGG - Intronic
1071090363 10:81911306-81911328 TACATAGTGAAAGCCTGCTATGG + Intronic
1075495459 10:122915443-122915465 CCCCTAGTGAAGGCCGAATTGGG - Intergenic
1081795263 11:45814363-45814385 CCCAGAGTGAAAGCAGCCTGAGG - Intergenic
1084656655 11:70523588-70523610 ACCATAGACAAAGCCTGCTTAGG - Intronic
1090417175 11:126548548-126548570 CCCATAGTGGTAGCAGGTTTGGG + Intronic
1091702918 12:2675949-2675971 GCCAGAGGGAAAGCCGGATTTGG + Intronic
1093891572 12:24527469-24527491 CAAATAGTGAAAGCTGGTTTGGG + Intergenic
1098268068 12:68743745-68743767 CCCCTAGAGACAGCTGGCTTGGG + Exonic
1098917172 12:76269537-76269559 CCCATAGTGAAATTTGGTTTGGG + Intergenic
1099114441 12:78606872-78606894 CACATAGAGAAAGCCAGCTGTGG + Intergenic
1114130141 14:19782007-19782029 TTCAGAGTGAAAGCAGGCTTGGG + Intronic
1115359391 14:32484433-32484455 GCCATAGTGGAAGCCGGCGCCGG - Intronic
1123399260 15:19968216-19968238 GCCATAGTGGAAGACGGCATGGG - Intergenic
1124485549 15:30111898-30111920 GCCATATTCAAAGCCGTCTTGGG + Intergenic
1124518027 15:30385369-30385391 GCCATATTCAAAGCCGTCTTGGG - Intronic
1124540626 15:30580884-30580906 GCCATATTCAAAGCCGTCTTGGG + Intergenic
1124654506 15:31497680-31497702 CCCCAAGTCAAAGCCTGCTTGGG - Intronic
1132665644 16:1080266-1080288 CCCAGAGGGAAGGCCGGCATGGG - Intergenic
1135633625 16:24055640-24055662 CCCAATTTGAAAGCCTGCTTAGG - Intronic
1136277198 16:29186024-29186046 CCCACAGAGAGAGCTGGCTTTGG + Intergenic
1141959480 16:87394952-87394974 CCAATAGTTAAAGCTGGCCTGGG - Intronic
1142081577 16:88152068-88152090 CCCACAGAGAGAGCTGGCTTTGG + Intergenic
1151590328 17:75039458-75039480 CCCATATGGAAAACCAGCTTAGG + Intronic
1155419279 18:25636847-25636869 CCTAGAGTGAAAGTCGGATTTGG + Intergenic
1160697627 19:492255-492277 ACTATGGTGAGAGCCGGCTTGGG - Intronic
932734988 2:74248224-74248246 CCCATAGTTAAAGATGGCTTTGG + Intronic
933325394 2:80829948-80829970 CACAAAGTGAAGGCTGGCTTTGG - Intergenic
942984857 2:182127771-182127793 CTCATAGTGAAAGTCAGCATAGG + Intronic
947078726 2:226371827-226371849 CCCAGAGTGAGAGCCAGTTTAGG - Intergenic
948103802 2:235396750-235396772 CACATGGGGAAAGCCAGCTTAGG - Intergenic
948516074 2:238504674-238504696 CGCATGATGACAGCCGGCTTTGG - Intergenic
948553974 2:238794777-238794799 CCCACAGGGAGAGCCGGCTGTGG + Intergenic
948554003 2:238794907-238794929 CCCACAGGGAGAGCCGGCTGTGG + Intergenic
1184021021 22:41821637-41821659 CACATAGTGCAAGCCTGCTGTGG - Intronic
953821748 3:46212759-46212781 CCCAAAGTGAAAGAGGGCATTGG + Intronic
956167428 3:66407212-66407234 CACATAGAGCAAGCCAGCTTTGG + Intronic
956748954 3:72331376-72331398 CCCACAGAGAAAGGCGACTTTGG + Intergenic
960049587 3:113227263-113227285 CCCATAAAGGAAGCCAGCTTGGG - Intronic
969322947 4:6424099-6424121 CTCACAGGGAAAGCCGGATTAGG + Intronic
984890341 4:184486460-184486482 CCAACAGTGAAAGCCTGCCTCGG + Intergenic
985142119 4:186851549-186851571 CCTAGAGGGAAAGCCGGCATTGG + Intergenic
985825049 5:2185511-2185533 CCCATAGTGACAGCCTGTTGTGG - Intergenic
993007765 5:82446698-82446720 CCAATGGTGAAAGCCAGCCTAGG - Intergenic
995468791 5:112478722-112478744 CCAAAAGAGAAAGCCAGCTTTGG - Intergenic
1012305869 6:97656430-97656452 CCCCTACTGAAAGCAGTCTTTGG + Intergenic
1015230232 6:130906842-130906864 CCCATCATGAAAGCAGGCTGAGG - Intronic
1023520649 7:41046935-41046957 TCCATAGTGACAACAGGCTTCGG + Intergenic
1023858817 7:44204076-44204098 CCCATAGTGAGTGCTGGCTCAGG - Intronic
1028989675 7:97035593-97035615 CCAACAGTGACAGCCGGCTGGGG + Intergenic
1032784536 7:135190109-135190131 CCCATAGTGAAAGCCGGCTTTGG - Intronic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1039107817 8:34008246-34008268 AACATAGTGAAAGCCTGCTAGGG - Intergenic
1051229231 9:14937010-14937032 CCCATAGAGAATACAGGCTTAGG + Intergenic
1195470133 X:105220707-105220729 CCCAGAGTAAAAGCCGACGTTGG - Intronic