ID: 1032785769

View in Genome Browser
Species Human (GRCh38)
Location 7:135198141-135198163
Sequence CTTTTCCTCTAGGGCACCAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032785769_1032785774 12 Left 1032785769 7:135198141-135198163 CCCTTGGTGCCCTAGAGGAAAAG 0: 1
1: 0
2: 0
3: 18
4: 152
Right 1032785774 7:135198176-135198198 AAGTCTCTTCCCATCTGCCCAGG 0: 1
1: 0
2: 1
3: 27
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032785769 Original CRISPR CTTTTCCTCTAGGGCACCAA GGG (reversed) Exonic
900265130 1:1753452-1753474 CTTGTCCCCTAGGGCACCACAGG - Intronic
902278560 1:15357694-15357716 CCTTTCCTCCAGGGCTCCAGCGG - Intronic
907021407 1:51069877-51069899 CTTTTCCTCTATGACATAAATGG + Intergenic
911778157 1:101841585-101841607 CTGTTCCTCTGAGGCACCAATGG - Intronic
912508449 1:110172443-110172465 CTTTTCCTCCTTAGCACCAATGG - Intronic
914588190 1:149081549-149081571 CTTTGCCTCTTGGGCCTCAACGG + Intronic
919314598 1:195955087-195955109 CATTTCCTCTGGGGCTTCAAAGG + Intergenic
920811256 1:209287965-209287987 CCTTTCCTCTTGGCCCCCAAAGG - Intergenic
921511039 1:216030881-216030903 TTTGTCCTTTAGGGAACCAAAGG + Intronic
922078944 1:222275712-222275734 CTGTCTCTCTAGGACACCAAGGG + Intergenic
923536388 1:234855370-234855392 CTATTACTCTCGGACACCAATGG + Intergenic
924297011 1:242597748-242597770 CTTTACCTCAAGGGTTCCAATGG - Intergenic
924852840 1:247847829-247847851 CTTTAGCTCTAGGGCAACAAGGG + Intergenic
1064568797 10:16671423-16671445 CATTTCCTCAAAGGCCCCAAAGG + Intronic
1066291392 10:34017436-34017458 CTCTTCCTCTGGGGCACCTGAGG + Intergenic
1066809661 10:39311993-39312015 CTTTTCCACATGAGCACCAAAGG + Intergenic
1068543260 10:58319767-58319789 CCTTTTCCCTAGGACACCAATGG + Intergenic
1069395969 10:67988248-67988270 CTTTTGCTGTAGGGTACTAATGG - Intronic
1071436108 10:85649421-85649443 CTTTGCCTGAAGGGCCCCAAGGG + Intronic
1071452729 10:85813122-85813144 CTCTTCTTCTGGGGCTCCAATGG - Intronic
1071968988 10:90883200-90883222 CTTTGCCTCTATGGCACAAAAGG - Intronic
1072548334 10:96457561-96457583 CTTTTCCTCAAGGGCTCTCAGGG + Intronic
1076686587 10:132200921-132200943 CTGATCCCCGAGGGCACCAACGG + Exonic
1086445541 11:86867036-86867058 CTCTTTCTCTAGGGCACAATGGG - Intronic
1087464834 11:98491112-98491134 CTTTACCTCAAGGGTACCAATGG + Intergenic
1089248132 11:117137408-117137430 CTCATCCCCTAGGGCAGCAAGGG - Intergenic
1089258581 11:117207153-117207175 CTCATCCCCTAGGGCAGCAAGGG + Exonic
1089596087 11:119581252-119581274 TTTTACCTTTAGGGCAACAATGG - Intergenic
1090292844 11:125560921-125560943 CTTTTCCTTAAGGGTTCCAATGG - Intergenic
1090334332 11:125952833-125952855 CTTTACCTCTTGGTCTCCAAAGG + Intergenic
1093416604 12:18927680-18927702 TTTTTCCTTTAGTGCATCAATGG - Intergenic
1095080001 12:37988404-37988426 TTTTTCCCCTTGGGCACCAATGG - Intergenic
1095470228 12:42528956-42528978 CTTTGCCTCTAAGCCACCACCGG + Intronic
1096552505 12:52382405-52382427 CATCTTCTCTAGGGCACCCAAGG - Intronic
1096776403 12:53966943-53966965 CTTTTCCTCCAGGGTAGCACTGG + Intergenic
1098306968 12:69112027-69112049 CCTTTCCCCTTGGGCAGCAATGG - Intergenic
1099842246 12:87980840-87980862 CTGTTCCTCTAGGGCACTGGCGG - Intronic
1103241696 12:119418830-119418852 CTGTTTCTCTAGGACACCAAGGG - Intronic
1107068222 13:36240599-36240621 CTTTTGCTCCAGGGTACCAATGG + Intronic
1107111506 13:36702890-36702912 CTTTACCTCAAGGGTTCCAATGG + Intergenic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1108759993 13:53551607-53551629 CTATTCCTCTTGGGCAACATTGG - Intergenic
1109677639 13:65700150-65700172 CTTCTCCTCTATGGCTCTAACGG + Intergenic
1111450233 13:88405679-88405701 GTTTTCCTCCAGGGCACCGGTGG - Intergenic
1115289935 14:31758923-31758945 CTTTTCCTCCATGGCACAATAGG + Intronic
1117127198 14:52641780-52641802 CTTTTTCTCTAAGGCAGGAAAGG - Exonic
1118985632 14:70752434-70752456 GTTTTCCTCTAGAGGACCCAGGG - Intronic
1120781125 14:88486565-88486587 CATTTCCTCTAAGGAACCAAGGG + Intronic
1121267266 14:92612434-92612456 CCTTCCCTCTAGGGCCCCAAAGG - Intronic
1125743063 15:41980884-41980906 CTTCTCCTCAAGGTCACCAATGG - Intergenic
1129125557 15:73437893-73437915 CTTGTCATCTAGGGGACCCAAGG + Intergenic
1130179101 15:81607123-81607145 CATTTCCTCAAGGGCAGCCAAGG - Intergenic
1130706188 15:86235381-86235403 GTTTTACTCTAGGGAATCAAAGG + Intronic
1132091624 15:98952095-98952117 CTTTTACTCTAGGGCACAGCAGG - Intronic
1134211326 16:12279873-12279895 CTGTTCCTCTGGGGGAACAAGGG + Intronic
1136088772 16:27903641-27903663 CTCTCCCTCCAGGGCCCCAAGGG - Intronic
1137698161 16:50476641-50476663 CTTTTCCTCCAGCTCACCCAGGG - Intergenic
1137760309 16:50935064-50935086 CTTCTTTTCTTGGGCACCAAGGG + Intergenic
1137834855 16:51582437-51582459 ATTTTCATCTAGGGAACAAATGG - Intergenic
1143866237 17:9926038-9926060 CCTTTCCTCCAGGCCACCACTGG + Intronic
1144426639 17:15149086-15149108 CTTTACCTTTAGGGTTCCAATGG - Intergenic
1145755676 17:27388534-27388556 CTTGTCCTCCAGGCCACCAGGGG - Intergenic
1146505067 17:33397674-33397696 CTCTTTCTCTAGGGTTCCAAGGG - Intronic
1147243883 17:39108307-39108329 CTTTTCCCCAAGGGCAAGAAGGG + Intronic
1147268201 17:39247572-39247594 CTTTTCCACCAGGGCACCGGGGG + Intergenic
1148728168 17:49811463-49811485 TTTTTCCTTTTAGGCACCAACGG + Exonic
1153017176 18:594432-594454 CTTTTTCTATGGGGCTCCAAGGG + Intergenic
1153828210 18:8896683-8896705 CTTTTCCTCCAGGGGGCCACTGG - Intergenic
1155803461 18:30137690-30137712 CTTTACCTCAAGGGTTCCAATGG + Intergenic
1155811335 18:30239468-30239490 CATTTCCCCTAGGTCAGCAATGG - Intergenic
1160602681 18:80025923-80025945 CTATTCCTCCAGTGCTCCAAAGG + Intronic
1162198088 19:9000795-9000817 CTCTTCCTCTGGGGCAGCAGGGG - Intergenic
1164461303 19:28451043-28451065 GTTTACCTCTAGGGTTCCAATGG - Intergenic
1164826998 19:31291123-31291145 CTGCTCCTCTAGGGAACCCATGG + Intronic
1167398172 19:49245372-49245394 CTGCTCCTCTAGGGCTGCAATGG + Intergenic
928938229 2:36702611-36702633 CTCTTCCCCTTGGCCACCAACGG + Intronic
929902282 2:46015509-46015531 CATTTTCCCTAGGGCAGCAAGGG - Intronic
930757658 2:54993738-54993760 GTTTTCCTCCAGGGCTCTAAAGG - Intronic
930764322 2:55069603-55069625 AGTTTCCTCTAAGGCACTAAGGG + Intronic
931069528 2:58629073-58629095 ATTTTGATCTAGAGCACCAAAGG + Intergenic
932929214 2:76013869-76013891 AGATTCCTCTAGGGGACCAAAGG + Intergenic
935788653 2:106571141-106571163 CTCTTCCTCTCGGGCATCACGGG - Intergenic
936068281 2:109348413-109348435 CCTGTCCTCTAGGGCACCTGAGG + Intronic
937850706 2:126632525-126632547 CTTTTCCTCTAAGCCACAAGAGG + Intergenic
938278788 2:130050514-130050536 TTTTTCATTTAGGTCACCAAGGG + Intergenic
938329762 2:130441373-130441395 TTTTTCATTTAGGTCACCAAGGG + Intergenic
938360184 2:130680130-130680152 TTTTTCATTTAGGTCACCAAGGG - Intergenic
938436587 2:131286838-131286860 TTTTTCATTTAGGTCACCAAGGG - Intronic
940330168 2:152465778-152465800 CTTTGCCTCGAGGGCACCTGTGG + Intronic
946354161 2:219174536-219174558 CTATTCCTCCAGGGCCCCACAGG - Intronic
947776349 2:232713916-232713938 CAGTTCCTCAAGGGCACCAGGGG - Intronic
1174963778 20:55187572-55187594 CTTTTCTTTTAGGACAACAAAGG + Intergenic
1179631877 21:42683873-42683895 CTTCTCCTCCTGGGCACAAAGGG - Intronic
1180198397 21:46210734-46210756 CTTTGTGTGTAGGGCACCAACGG - Exonic
1181363152 22:22354228-22354250 CTTCTCCTCTATTGCACCATTGG + Intergenic
1182168221 22:28198319-28198341 CTTTTCCTCTGGGGCACATTTGG - Intronic
1184188034 22:42877591-42877613 TTTTCCCTCTGGAGCACCAAAGG - Intronic
952143105 3:30501417-30501439 CTTTTTCGCTTGGGCACAAAGGG - Intergenic
952642727 3:35616987-35617009 CTTCTCCTCTTGGTCACAAATGG - Intergenic
955921869 3:63965462-63965484 ATTTTACTCTAGTGCACAAAGGG - Intronic
957561561 3:81828546-81828568 TTTTTCCTATATGGCACTAATGG + Intergenic
957852088 3:85821313-85821335 ATTTACCTCTAGGCCACCAGAGG + Intronic
960464916 3:117985841-117985863 ATTTTCCTTAAGGGCAGCAAAGG + Intergenic
969149613 4:5158265-5158287 CTTTACCCTGAGGGCACCAAGGG + Intronic
969238630 4:5885588-5885610 CTTTACCTCTGGGGCCCCATGGG + Intronic
971233775 4:24822640-24822662 CTTTTCTACTAGGGCACCAGTGG - Intronic
971772459 4:30914859-30914881 CTTGTCCTCTAGGTCACGTAAGG + Intronic
977572706 4:98646136-98646158 CTTCTCCTCTAGGGCATAATGGG - Intronic
980937056 4:139235640-139235662 CTTTACCTCAAGGGTTCCAATGG + Intergenic
982206283 4:152999456-152999478 CTTTTCCTTTAGGGGAAGAAAGG + Intergenic
984087654 4:175332307-175332329 ATTTTCCTCTAGGGTCCCTAAGG - Intergenic
987266061 5:16256198-16256220 CTTTTCCTCTAGGGGACTTTTGG - Intergenic
987757556 5:22116170-22116192 CTTTTCCTTTATGGCAGAAAAGG + Intronic
987841891 5:23232864-23232886 CTTTCCCTCAAGGGTTCCAATGG + Intergenic
988463518 5:31465056-31465078 TTTTTCCTTGAGTGCACCAACGG + Intronic
989169423 5:38459810-38459832 CATTTCCTCTAGGGTTTCAAAGG - Intronic
990543658 5:56800246-56800268 CTTTTCCTCCAGGGTCCCAGGGG - Intergenic
990689978 5:58353169-58353191 CAATCCCTCTAGGACACCAAAGG + Intergenic
991272337 5:64799037-64799059 CTTTTCCTCTAGGCCCCTATGGG - Intronic
993094918 5:83471115-83471137 CTTTCCCTCTAGGTCCCCGAAGG + Intergenic
993333471 5:86628115-86628137 TTTTACCTCTAAGGCACCAAGGG - Intergenic
994028088 5:95108210-95108232 CCTTTCCTTTAGGGCAGCTAAGG - Intronic
994991746 5:107005372-107005394 CTCTTCCTTTAGGTCAACAAAGG + Intergenic
998021123 5:138771307-138771329 ATTTTTCTTGAGGGCACCAAAGG - Intronic
1002655307 5:180741664-180741686 CTTTTCCACAAGGGCATCAAGGG - Intergenic
1005761737 6:28973793-28973815 CTTTTTTTGTAGGGCACCAGTGG - Intergenic
1007760252 6:44128809-44128831 ATTGTCCTCCAGGGCACCAGAGG + Intronic
1010064977 6:71672024-71672046 CCTCTCCTCTAGGACATCAACGG - Intergenic
1010209947 6:73354555-73354577 CTCTTCCTCTAGGGAACAACCGG + Intergenic
1013127888 6:107202795-107202817 CTTTTTCTCCAGTGAACCAAAGG - Intronic
1015152081 6:130051531-130051553 CTTTTCCTTTAGGGCCACATGGG + Intronic
1018376049 6:163213786-163213808 CTTTTCCTCAAGGACAGTAAGGG + Intronic
1021944437 7:25712526-25712548 GTTTTCCTCTAGGACACAACTGG - Intergenic
1022382165 7:29870665-29870687 CTTTACCTCCAGGGAAGCAAAGG + Intronic
1022595250 7:31707328-31707350 TTTTTTCTCTAGGTCACCACAGG - Exonic
1024000457 7:45185948-45185970 TGTTTTCTCCAGGGCACCAAGGG + Intronic
1024616738 7:51121486-51121508 CTTTTACTTTTGTGCACCAAAGG - Intronic
1025875989 7:65479970-65479992 CTCTTCCCCTAGGGAACTAATGG + Intergenic
1029903334 7:104065878-104065900 GCTTTCCTCTGGGACACCAAGGG - Intergenic
1030165024 7:106545412-106545434 CTTTTCCTCTTAGACAGCAAGGG + Intergenic
1030735009 7:113037705-113037727 CTTTTCCTCTGACACACCAAGGG - Intergenic
1031876600 7:127148804-127148826 ATTTTTGTCAAGGGCACCAAGGG + Intronic
1032785769 7:135198141-135198163 CTTTTCCTCTAGGGCACCAAGGG - Exonic
1034540725 7:151756330-151756352 CTCTGCCTCTGAGGCACCAAAGG + Intronic
1034890958 7:154838814-154838836 CTTTTCCTCGAGGGACCCACCGG - Intronic
1036723000 8:11195189-11195211 CTTTTCCTTGATGGTACCAAAGG + Intronic
1036743508 8:11388305-11388327 CTCTTCCTCCAGGGAATCAAAGG + Intergenic
1037481369 8:19308939-19308961 ATTTCCCTCTTTGGCACCAAAGG - Intergenic
1037553345 8:19996728-19996750 CTTTTCCTCTAGGGAACAAGTGG - Intergenic
1040126233 8:43740699-43740721 TTTTTCCCATAGGGCTCCAAGGG - Intergenic
1042721912 8:71835094-71835116 CTTTTCCTCTCAGGCTCCTAAGG + Intronic
1048438860 8:134445049-134445071 AATTGCTTCTAGGGCACCAAGGG - Intergenic
1049415720 8:142493963-142493985 TGTTTCCACCAGGGCACCAAGGG + Intronic
1049861820 8:144903816-144903838 CTTCTCCTATAGGGCAACAAAGG + Intergenic
1054372157 9:64412887-64412909 CTTTTTACCTAGGGCATCAAAGG + Exonic
1057914848 9:99047774-99047796 TTTTGCCTCTAGGGGCCCAAAGG + Exonic
1058053818 9:100430360-100430382 CTTTACCCCAAGGCCACCAAGGG - Intronic
1058367226 9:104223004-104223026 TCTTTCCTCTGGGGCATCAAAGG - Intergenic
1059767604 9:117398597-117398619 CTTCCCCTCTTTGGCACCAAAGG + Intronic
1059915734 9:119097772-119097794 ATATTCCACGAGGGCACCAAGGG - Intergenic
1061061660 9:128253678-128253700 CTTTTACCCTAGGTCACCACTGG - Intronic
1061112195 9:128581864-128581886 CTTTTCCTCCTGGGCACTAAGGG - Exonic
1061449884 9:130662202-130662224 CAGTTCCTCCAGGACACCAAAGG - Intergenic
1061791529 9:133061650-133061672 CTTGTCCCCTAGGTCCCCAAAGG - Intergenic
1062534492 9:137015470-137015492 CTCTTCCTCAAGGGCACCTATGG - Exonic
1185646276 X:1617997-1618019 TTTTACCTCTAGGCCCCCAAGGG + Intronic
1190025014 X:46913998-46914020 CTTTCCCTCCAGGCCACCACTGG - Intronic
1194305627 X:92244358-92244380 CTTTTGCTTTAGGGTCCCAAGGG - Intronic
1195000337 X:100637094-100637116 CCTTCTCTCTAGGGCACCAGGGG - Intronic
1197243122 X:124140966-124140988 CTTTACCTCAAGGGTTCCAATGG + Intronic
1199137801 X:144273594-144273616 CTCTTCCTCTTGGACACTAATGG + Intergenic